View Full Table | Close Full ViewTable 1.

Primers used for real-time PCR analysis

 
Genes Primers Sequences (5′-3′) Size
Slc1a5 Forward GATTGTGGAGATGGAGGATGTGG 128 bp
Reverse TGCGAGTGAAGAGGAAGTAGATGAGA
Slc6a19 Forward TCTGTCCACAACAACTGCGAG 206 bp
Reverse CAGCGAAGTTCTCCTGCGTC
Slc7a9 Forward GAACCCAAGACCACAAATC 180 bp
Reverse ACCCAGTGTCGCAAGAAT
Slc7a7 Forward AGGAGAACCCACAGATTAGC 113 bp
Reverse GCGGAGGAGGAGAAGAA
Slc1a1 Forward GGCACCGCACTCTACGAAGCA 177 bp
Reverse GCCCACGGCACTTAGCACGA
Slc15a1 Forward CATCGCCATACCCTTCTG 144 bp
Reverse TTCCCATCCATCGTGACATT
GAPDH Forward AAGGAGTAAGAGCCCCTGGA 140 bp
Reverse TCTGGGATGGAAACTGGAA



View Full Table | Close Full ViewTable 2.

Antibodies used for Western blot analyses

 
Antiprotein Gene Catalog number Dilution
Primary antibodies
    ASCT2 Slc1a5 sc1309631 1:500
    B0AT1 Slc6a19 sc1608111 1:1,000
    b0,+AT Slc7a9 ab400332 1:1,000
    y+LAT1 Slc7a7 sc345511 1:500
    EAAC1 Slc1a1 ab783952 1:1,000
    PEPT1 Slc15a1 sc199171 1:500
    β-actin β-actin sc477781 1:1,000
Secondary antibodies
    Chicken IgG 14-24-063 1:3,000
    Rabbit IgG sc-20041 1:3,000
    Goat IgG sc-27681 1:3,000
    Mouse IgG ab67892 1:3,000
1Santa Cruz Biotechnology, Inc. (Santa Cruz, CA).
2Abcam, Cambridge, UK.
3KPL, Gaithersburg, MD.



View Full Table | Close Full ViewTable 3.

Effects of dietary supplementation with N-carbamylglutamate (NCG) on growth performance of weaned Huanjiang mini-pig piglets1,2

 
Dietary treatment
Item Control NCG P-value
BW, kg
    Initial 3.2 ± 0.2 3.2 ± 0.1 0.817
    inal 4.3 ± 0.3 4.5 ± 0.2 0.524
ADFI, g
    d 0 to 7 139 ± 15 139 ± 7 0.997
    d 7 to 14 207 ± 14 205 ± 15 0.917
    d 0 to 14 173 ± 14 172 ± 13 0.948
ADG, g/d
    d 0 to 7 60 ± 6 57 ± 8 0.834
    d 7 to 14 98 ± 2 124 ± 6 0.021
    d 0 to 14 79 ± 4 91 ± 2 0.034
G:F, g/g
    d 0 to 7 0.467 ± 0.026 0.415 ± 0.049 0.373
    d 7 to 14 0.582 ± 0.039 0.723 ± 0.042 0.034
    d 0 to 14 0.523 ± 0.010 0.597 ± 0.029 0.049
1NCG = diet with 0.1% N-carbamylglutamate.
2n = 6.



View Full Table | Close Full ViewTable 4.

Effects of dietary supplementation with N-carbamylglutamate (NCG) on plasma biochemical variables in weaned Huanjiang mini-pig piglets1,2

 
Dietary treatment
Item Control NCG P-value
Alkaline phosphatase, units/L 302.3 ± 11.3 342.6 ± 15.1 0.048
Low density lipoprotein, mmol/L 0.81 ± 0.04 0.63 ± 0.03 0.007
High density lipoprotein, mmol/L 0.78 ± 0.13 0.62 ± 0.06 0.311
Glucose, mmol/L 6.92 ± 0.35 6.86 ± 0.61 0.858
Ammonia, μmol/L 87.13 ± 1.67 82.40 ± 0.91 0.043
Triglycerides, mmol/L 0.48 ± 0.05 0.56 ± 0.09 0.463
Total protein, g/L 51.08 ± 2.68 52.23 ± 2.45 0.758
Albumin, g/L 29.80 ± 1.31 29.38 ± 1.36 0.830
Cholesterol, mmol/L 1.62 ± 0.18 1.51 ± 0.12 0.624
Urea nitrogen, mmol/L 3.97 ± 0.13 3.35 ± 0.15 0.023
1NCG = diet with 0.1% N-carbamylglutamate.
2n = 6.



View Full Table | Close Full ViewTable 5.

Effects of dietary supplementation with N-carbamylglutamate (NCG) on AA contents of plasma, liver, and muscle in weaned Huanjiang mini-pig piglets1,2

 
Dietary treatment
Liver, %
Muscle, %
Plasma, µmol/L
P-value
Item Control NCG Control NCG Control NCG Liver Muscle Plasma
Asp 204.7 ± 8.7 203.9 ± 10.9 238.3 ± 2.8 240.1 ± 4.9 46.5 ± 3.2 42.4 ± 2.8 0.995 0.760 0.769
Thr 99.5 ± 4.6 100.0 ± 5.6 119.9 ± 1.5 119.3 ± 2.8 371.5 ± 16.4 381.4 ± 18.9 0.944 0.871 0.798
Ser 92.3 ± 4.4 89.5 ± 7.3 100.6 ± 1.4 97.7 ± 2.7 161.1 ± 12.4 137.6 ± 17.6 0.751 0.363 0.490
Glu 312.8 ± 13.8 294.4 ± 25.2 423.1 ± 6.2 430.2 ± 8.9 509.0 ± 17.3 457.2 ± 15.2 0.534 0.530 0.028
Gly 119.6 ± 4.8 118.8 ± 4.0 117.4 ± 1.5 119.5 ± 1.5 1,147.4 ± 28.5 944.5 ± 20.6 0.902 0.333 0.007
Ala 123.8 ± 5.7 126.4 ± 1.2 143.0 ± 1.7 144.4 ± 2.1 651.7 ± 25.2 571.2 ± 18.7 0.659 0.627 0.015
Cys 65.4 ± 1.7 65.5 ± 0.8 71.6 ± 0.3 71.0 ± 0.9 138.4 ± 12.5 163.4 ± 8.0 0.924 0.537 0.022
Val 146.5 ± 5.5 146.1 ± 4.3 147.8 ± 1.7 151.1 ± 2.1 324.8 ± 18.0 362.9 ± 17.5 0.963 0.266 0.040
Met 56.9 ± 2.4 58.5 ± 1.1 59.6 ± 0.8 59.3 ± 0.9 52.3 ± 8.7 69.3 ± 4.5 0.553 0.770 0.031
Ile 113.4 ± 4.4 112.2 ± 4.2 125.9 ± 2.2 129.4 ± 2.6 123.4 ± 11.8 151.7 ± 14.1 0.840 0.337 0.047
Leu 210.0 ± 8.9 208.9 ± 7.0 208.1 ± 2.7 209.3 ± 4.5 178.1 ± 17.0 190.4 ± 18.3 0.927 0.828 0.771
Tyr 89.8 ± 3.8 92.9 ± 2.6 104.5 ± 7.2 88.0 ± 10.8 176.2 ± 19.3 163.3 ± 15.0 0.527 0.232 0.833
Phe 165.8 ± 3.9 163.1 ± 4.8 121.0 ± 1.2 119.9 ± 2.0 101.0 ± 6.9 121.9 ± 5.6 0.676 0.646 0.034
Lys 190.4 ± 7.8 191.9 ± 6.9 217.4 ± 4.5 220.5 ± 5.4 251.7 ± 17.4 243.7 ± 9.5 0.884 0.666 0.681
His 73.2 ± 2.8 72.5 ± 2.5 114.1 ± 3.2 112.0 ± 5.5 120.5 ± 7.6 111.1 ± 7.4 0.853 0.754 0.667
Arg 131.8 ± 6.5 134.3 ± 3.1 157.7 ± 2.3 160.0 ± 3.6 169.0 ± 14.2 203.8 ± 12.4 0.743 0.609 0.026
Pro 171.0 ± 11.5 165.6 ± 3.4 166.1 ± 1.7 168.5 ± 2.0 639.4 ± 24.8 515.9 ± 18.3 0.672 0.375 0.044
1NCG = diet with 0.1% N-carbamylglutamate
2n = 6.