View Full Table | Close Full ViewTable 1.

Primer sets used in this study

 
Gene Gene abbreviation UniGene access code Forward sequence Reverse sequence
Collagen type I, alpha 1 COL1A1 NM_001034039.1 CCACCCCAGCCGCAAAGAGT ACGCAGGTGACTGGTGGGATGTC
Collagen type III, alpha 1 COL3A1 NM_001076831.1 GGCCCCCTGGAAAGGACGGA CCCCGCCAGCACCACAACAT
Fibronectin 1 FN1 NM_001163778.1 GCGTGTCACCTGGGCTCCAC CGGTGCCGGGCAGGAGATTT
Transforming growth factor, beta 1 TGFβ-1 NM_001166068.1 AGCCAGGGGGATGTGCCA TAGCACGCGGGTGACCTCCT
CCAAT enhancer binding protein, alpha C/EBPα NM_176784.2 TGCGCAAGAGCCGGGACAAG ACCAGGGAGCTCTCGGGCAG
CCAAT enhancer binding protein, beta C/EBPβ NM_176788.1 CGGGCAGCACCACGACTTCC CCCCAGTCGGCCCAGACTCA
Peroxissome proliferator actiated-receptor gamma PPARγ NM_001098905.1 TGGAGACCGCCCAGGTTTGC AGCTGGGAGGACTCGGGGTG
Fibroblast growth factor 2 (basic) FGF2 NM_174056.3 GGAGCATCACCACGCTGCCA GTGGGTCGCTCTTCTCGCGG
Fibroblast growth factor receptor 1 FGFR1 NM_001110207.1 AGGAGGATCGAGCCCACGGC CTTGCTCCGGCAAGGTCGGGG
Zinc finger protein 423 Zfp423 NM_001101893.1 GGATTCCTCCGTGACAGCA TCGTCCTCATTCCTCTCCTCT
Myogenic differentiation 1 MYOD NM_001040478.2 TTCCGACGGCATGATGGACTAC TAAGTGCGGTCGTAGCAGTTCC
Myogenin (Myogenic factor 4) MYOG NM_001111325.1 TACAGACGCCCACAATCTGCAC AGCGACATCCTCCACTGTGATG
18 S ribosomal 18S NM_001033614 CCTGCGGCTTAATTTGACTC AACTAAGAACGGCCATGCAC