View Full Table | Close Full ViewTable 1.

Number of Brahman and Angus cattle by gender, HGP-status, and genotype (number of favorable alleles) for calpain-system gene markers in the New South Wales (NSW) and Western Australian (WA) experiments

 
Variable Experimental site
NSW NSW WA WA
Breed Brahman Angus Brahman Angus
Gender
    Heifers 82 24
    Steers 82 25 173 20
HGP
    No HGP 83 24 86 10
    HGP 81 25 87 10
CAST1
    0 66 51
    1 10 61
    2 88 49 61 20
CAPN31
    0 88 43
    1 8 1 74
    2 71 48 56 20
CAPN1–47511
    0 89 1 83
    1 67 18 75 4
    2 8 30 15 16
CAPN1–3161
    0 149 17 145 4
    1 15 21 27 12
    2 0 11 1 4
1Gene markers for CAST = calpastatin; CAPN3 = calpain 3; and CAPN1–4751 and CAPN1–316 = calpain 1.



View Full Table | Close Full ViewTable 2.

Oligonucleotide sequences used to synthesize complementary DNA

 
Primer name1 Oligonucleotide sequence (5′-3′)
CALP1cdna CATCCGCATTTCATAG
CALP3cdna TGCTATCTGCCTGAAA
CASTcdna TCAGCTTTTGGCTTGG
RPLP0cdna ATGGATCAGCCAAGAA
CASTIIIcdna GCGGAGGGGGCGATG
CASTIIcdna TCTTGTACCACCAGCTT
CASTIII ex5–6cdna TGGCTCTGTGTGTTCCTTTG
OligodT-VN TTTTTTTTTTTTTTTTVN
Adapter-oligodT2 GACATCGTACCTGACTCATCGCACTT-TTTTTTTTTTTTTTTTTT
1Abbreviated mRNA transcript identifiers for CALP1 = calpain 1; CALP3 = calpain 3; CAST = ‘total’ calpastatin; RPLP0 = Ribosomal Protein, Large, P0; CASTIII= type III calpastatin splice variant; CASTII = type II calpastatin splice variant; CAST ex5-6 = calpastatin exon5-exon6; OligodT-VN= thymidine homopolymer with 3’ degenerate nucleotides (V = A,C,G and N= A,C,G,T).
2The underlined portion of the Adapter-oligodT sequence highlights the antisense primer sequence which was used to quantitatively measure the calpastatin mRNA polyadenylation variants.



View Full Table | Close Full ViewTable 3.

Oligonucleotide sequences used for quantitative reverse transcriptase PCR assays (qRT-PCR)

 
Assay name1 Accession number Oligonucleotide sequence (5′-3′)
CALP1 NM_174259 Sense: GGACATGGAGATCAGGCGTCAA
Antisense: AACTCCACCAGGCCCAGTTT
CALP3 NM_174260 Sense: TCCCACCTAAATACCAACATCT
Antisense: CCTGAGAGGGCATCAATGG
CAST NM_001030319 Sense: GAAGCCCAAGGCATCAGAGA
Antisense: AGCAGGCTTCTTGTCTTTGTC
RPLP0 NM_001012682 Sense: CAACCCTGAAGTGCTTGACAT
Antisense: GCAAGTGGGAAGGTGTAATCA
CASTII NM_174003 Sense: TTAGTCCCAGTCAGGTCTGC
Antisense: ACGATGGATGTGTTCCGAGA
CASTIII (ex3) AH014526 Sense: AAGCCGGGCTGAAGTCTC
Antisense: TGTTAGGAGAATGCGGTCCT
CASTIII (ex2–ex4) AH014526 Sense: AAGCCGGGCTGAAGTCTC
Antisense: TCAGGTTCTGTTTTTACAGCCTT
CASTpA12 AH014526 Sense: CAGCATGTGGCTTAATGGAA
Antisense: CGTACCTGACTCATCGCACTT
CASTpA22 AH014526 Sense: AACGGACTTCTCCAAAAGCA
Antisense: CGTACCTGACTCATCGCACTT
1Abbreviated mRNA transcript identifiers for CALP1 = calpain 1; CALP3 = calpain 3; CAST = ‘total’ calpastatin; RPLP0 = Ribosomal Protein, Large, P0; CASTII = type II calpastatin splice variant; CASTIII (ex3) = type III calpastatin splice variant containing exon 3; CASTIII (ex2-ex4) = type III calpastatin splice variant lacking exon 3; CASTpA1 = calpastatin proximal polyadenylation variant; and CASTpA2 = calpastatin distal polyadenylation variant.
2The antisense primer corresponds to the underlined sequence in the Adapter-oligodT primer in Table 2.



View Full Table | Close Full ViewTable 4.

Significance (P-values) of the terms fitted in the linear models1

 
Dependent variable2 Terms fitted (P-values)
K B S H CAPN1(B) CAST(B) S*H B*S B*H K*B K*H CAST(B)*S
CALP13 < 0.0001 0.06 . 0.68 0.0018 . . . 0.018 . . .
CALP33 0.03 0.21 . . . . . . . < 0.0001 . .
“total” CAST3 0.004 0.02 . 0.01 . . . . . 0.005 . .
CASTIIIex2-ex43 < 0.0001 0.0006 . 0.002 . 0.03 . . . 0.002 . .
CASTIIIex33 0.01 < 0.0001 < 0.0001 0.01 . . . 0.004 0.02 . 0.02 .
CASTII (replicate 1)3 0.008 < 0.0001 0.41 0.71 . < 0.0001 0.03 . . . . .
CASTII (replicate 2)3 0.006 < 0.0001 . . . < 0.0001 . . . . . .
CASTII (replicate 3)4 < 0.0001 0.0002 0.34 0.96 . 0.0018 0.043 . . . . .
CASTpA14 < 0.0001 0.1 0.21 0.0023 . 0.0007 . . . . 0.006
CASTpA24 0.0009 0.87 0.47 0.0002 . . . 0.016 . . . .
CASTpA1:CASTpA24 < 0.0001 0.0025 < 0.0001 . . 0.0002 . . . . . .
1K = Killgroup, B = Breed, S = Sex, H = HGP, CAPN1(B) = CAPN1–4751 nested within Breed, CAST(B) = CAST:c.2832A > G nested within Breed, S*HGP = Sex*HGP, B*S = Breed*Sex, B*H = Breed*HGP, K*B = Killgroup*Breed, K*H = Killgroup*HGP, CAST(B)*S = CAST(B)*Sex.
2Abbreviated mRNA transcript identifiers for CALP1 = calpain 1; CALP3 = calpain 3; CAST = ‘total’ calpastatin; RPLP0 = Ribosomal Protein, Large, P0; CASTII = type II calpastatin splice variant; CASTIII (ex3) = type III calpastatin splice variant containing exon 3; CASTIII (ex2-ex4) = type III calpastatin splice variant lacking exon 3; CASTpA1 = calpastatin proximal polyadenylation variant; and CASTpA2 = calpastatin distal polyadenylation variant.
3The initial phase of the experiment screened 152 cattle from NSW and 191 cattle from WA.
4The second phase of the experiment screened 213 cattle from NSW and 191 cattle from WA.



View Full Table | Close Full ViewTable 5.

Least squares (LS) means for the Breed × Genotype effects. Relative mRNA levels of genes measured in the LLM of Brahman and Angus cattle that were significantly associated with either the CAPN1–4751 or CAST:c.2832A > G DNA marker. The mRNA levels of the CAPN1, CASTIIIex2-ex4, and CASTII genes were normalized against the RPLP0 reference gene, while the CASTpA1 and CASTpA2 mRNA variants were analyzed as a within sample ratio (non-normalized). For CAPN1, the LS mean value in Angus cattle with 1 copy of the favorable allele was arbitrarily set to 1.00 with the other LS means within the same row expressed relative to this value. For CASTIIIex2-ex4, CASTII (replicates 1–3) and CASTpA1:CASTpA2, the LS mean value in Brahman cattle with 0 copies of the favorable allele was arbitrarily set to 1.00 with the other LS means within the same row expressed relative to this value

 
Dependent variable1 Genotype Brahman,0 copies Brahman,1 copy Brahman,2 copies Angus,1 copy Angus,2 copies
CAPN12 CAPN1–4751 1.06 ± 0.01bc 1.09 ± 0.02ac 1.15 ± 0.04a 1.00 ± 0.04b 1.09 ± 0.03abc
CASTIIIex2-ex42 CAST:c.2832A > G 1.00 ± 0.03a 0.96 ± 0.03ab 0.93 ± 0.02b . 0.85 ± 0.03c
CASTII (replicate 1)2 CAST:c.2832A > G 1.00 ± 0.03a 0.83 ± 0.05b 0.75 ± 0.03b . 0.52 ± 0.04c
CASTII (replicate 2)2 CAST:c.2832A > G 1.00 ± 0.04a 0.85 ± 0.05b 0.77 ± 0.03b . 0.52 ± 0.05c
CASTII (replicate 3)3 CAST:c.2832A > G 1.00 ± 0.03a 0.91 ± 0.04ab 0.86 ± 0.03b . 0.76 ± 0.04c
CASTpA1:CASTpA23 CAST:c.2832A > G 1.00 ± 0.02a 1.00 ± 0.02a 0.91 ± 0.02b . 0.89 ± 0.02b
a–cWithin rows, LS mean values without a common superscript differ significantly at P < 0.05.
1Abbreviated mRNA transcript identifiers for CALP1 = calpain 1; RPLP0 = Ribosomal Protein, Large, P0; CASTII = type II calpastatin splice variant; CASTIII (ex2-ex4) = type III calpastatin splice variant lacking exon 3; CASTpA1 = calpastatin proximal polyadenylation variant; and CASTpA2 = calpastatin distal polyadenylation variant.
2The initial phase of the experiment screened 152 cattle from NSW and 191 cattle from WA.
3The second phase of the experiment screened 213 cattle from NSW and 191 cattle from WA.



View Full Table | Close Full ViewTable 6.

Least squares (LS) means for the Breed × Genotype × Sex effects. Relative mRNA levels of the CASTpA1 variant measured in the LLM of Brahman and Angus were normalized against the RPLP0 reference gene. The LS mean value for CASTpA1 in Brahman cattle with 0 copies of the favorable CAST:c.2832A > G allele was arbitrarily set to 1.00 with the other LS means expressed relative to this value

 
Dependent variable1 Genotype Breed × Genotype (number of favorable alleles) Heifer Steer
CASTpA12 CAST:c.2832A > G Brahman (0) 1.00 ± 0.04ab 1.02 ± 0.02a
Brahman (1) 0.93 ± 0.1abcde 0.95 ± 0.03bcd
Brahman (2) 0.90 ± 0.04cd 0.89 ± 0.02d
Angus (2) 1.00 ± 0.05abc 0.78 ± 0.03e
a–eLS mean values without a common superscript differ significantly at P < 0.05.
1Abbreviated mRNA transcript identifier for CASTpA1 = calpastatin proximal polyadenylation variant; and RPLP0 = Ribosomal Protein, Large, P0.
2The second phase of the experiment screened 213 cattle from NSW and 191 cattle from WA.



View Full Table | Close Full ViewTable 7.

Least squares means for HGP (Hormone Growth Promotant), Sex, Sex*HGP, Sex*Breed, Breed*HGP. Relative mRNA levels measured in the LLM of Brahman and Angus were normalized against the RPLP0 reference gene

 
Dependent variable1 HGP (No)2 HGP (Yes)
“total” CAST3 1.00 ± 0.02b 1.05 ± 0.02a
CASTpA14 1.00 ± 0.02b 1.08 ± 0.02a
CASTpA24 1.00 ± 0.02b 1.09 ± 0.02a
CASTIIIex2-ex43 1.00 ± 0.02b 1.08 ± 0.02a
Dependent variable3 Steer2 Heifer
    CASTpA1:CASTpA24 1.00 ± 0.02b 1.12 ± 0.03a
Dependent variable1 Steer, HGP (Yes)2 Steer, HGP (No) Heifer, HGP (Yes) Heifer, HGP (No)
    CASTII (replicate 1)3 1.00 ± 0.05b 1.16 ± 0.05a 1.21 ± 0.09a 1.10 ± 0.09ab
    CASTII (replicate 3)4 1.00 ± 0.04ab 1.08 ± 0.04a 1.04 ± 0.06ab 0.95 ± 0.06b
Dependent variable1 Heifer, Brahman2 Steer, Brahman Heifer, Angus Steer, Angus
    CASTpA24 1.00 ± 0.03b 1.12 ± 0.02a 1.06 ± 0.05ab 1.01 ± 0.04b
    CASTIIIex33 1.00 ± 0.04b 0.84 ± 0.03c 1.41 ± 0.08a 0.96 ± 0.05b
Dependent variable1 Brahman, HGP (No)2 Brahman, HGP (Yes) Angus, HGP (No) Angus, HGP (Yes)
    CALP13 1.00 ± 0.02b 1.04 ± 0.02a 1.00 ± 0.03ab 0.94 ± 0.03b
    CASTIIIex33 1.00 ± 0.03c 1.00 ± 0.03c 1.40 ± 0.06a 1.17 ± 0.06b
a–cWithin rows, LS mean values without a common superscript differ significantly at P < 0.05.
1Abbreviated mRNA transcript identifiers for CALP1 = calpain 1; CAST = ‘total’ calpastatin; RPLP0 = Ribosomal Protein, Large, P0; CASTII = type II calpastatin splice variant; CASTIII (ex3) = type III calpastatin splice variant containing exon 3; CASTIII (ex2-ex4) = type III calpastatin splice variant lacking exon 3; CASTpA1 = calpastatin proximal polyadenylation variant; and CASTpA2 = calpastatin distal polyadenylation variant.
2The LS mean value in these columns was arbitrarily set to 1.00 with the other LS means within the same row expressed relative to this value.
3The initial phase of the experiment screened 152 cattle from NSW and 191 cattle from WA.
4The second phase of the experiment screened 213 cattle from NSW and 191 cattle from WA.