Search
Author
Title
Vol.
Issue
Year
1st Page

Journal of Animal Science - Animal Nutrition

Development of an antioxidant system after early weaning in piglets2

 

This article in JAS

  1. Vol. 92 No. 2, p. 612-619
     
    Received: Aug 01, 2013
    Accepted: Nov 18, 2013
    Published: November 24, 2014


    1 Corresponding author(s): yinyulong@isa.ac.cn
    tjli@isa.ac.cn
 View
 Download
 Share

doi:10.2527/jas.2013-6986
  1. J. Yin*†,
  2. M. M. Wu*†,
  3. H. Xiao*†,
  4. W. K. Ren*†,
  5. J. L. Duan*†,
  6. G. Yang,
  7. T. J. Li 1 and
  8. Y. L. Yin 1
  1. Scientific Observing and Experimental Station of Animal Nutrition and Feed Science in South-Central China, Ministry of Agriculture, Hunan Provincial Engineering Research Center of Healthy Livestock, Key Laboratory of Agro-ecological Processes in Subtropical Region, Institute of Subtropical Agriculture, Chinese Academy of Sciences, Changsha, Hunan 410125, China
    University of Chinese Academy of Sciences, Beijing 100039, China
    School of Food Science, Washington State University, Pullman 99164

Abstract

The objective of this experiment was to investigate oxidative injury and the development of an antioxidant system after early weaning in piglets. A total of 40 piglets (Landrace× Large White, weaned at 14 d after birth) were randomly slaughtered 0 (w0d), 1 (w1d), 3 (w3d), 5 (w5d), or 7 d (w7d; n = 8) after weaning. Concentrations of malondialdehyde (MDA), 8-hydroxydeoxyguanosine (8-OHdG), and protein carbonyl and the activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and catalase were measured in plasma. Gene expressions of antioxidant enzymes were determined by quantitative reverse transcription PCR analysis. The mediation of transcription factor 65 (p65) and the nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathways by oxidative stress was determined by Western blot analysis. Results showed that the plasma MDA level was significantly higher at 3 d (P < 0.05) and that the protein carbonyl level increased at 1, 3, and 5 d (P < 0.05) compared with w0d. In addition, early weaning suppressed the plasma activity of SOD at 1 d (P < 0.05) and reduced the GSH-Px activity at 3 d (P < 0.05). The expression results in the jejunum indicate that the genes related to antioxidant enzymes were downregulated (P < 0.05) at 3 and 5 d after weaning. Uncoupling protein 2 (Ucp2), which is considered to be a feedback regulation on reactive oxygen species generation, tended to decrease in the ileum (P < 0.05) after weaning. Tumor protein 53 (p53), which regulates reactive oxygen species generation, was enhanced (P < 0.05) in the jejunum after weaning. Meanwhile, early weaning suppressed p65 (at 3, 5, and 7 d; P < 0.05) and Nrf2 (at 5 and 7 d; P < 0.05) signals in the jejunum, which might feedback-regulate antioxidant gene expression and promote the development of the antioxidant system. Therefore, we speculate that weaning disrupted oxidative balance and caused oxidative injury in piglets, and this imbalance can recover with the development of an antioxidant system via feedback regulation.



INTRODUCTION

Weaning involves separation of the piglet from its sow, which results in breaking of the mother-offspring bond and removal of milk from the piglet’s diet (Kelley, 1980). Postweaning piglets may also be exposed to other stressors, including changes in their physical (housing, transport, and novel handling) and social (relocation with unfamiliar pen mates) environments (Van der Meulen et al., 2010). As a consequence, weaning stress occurs. Weaning stress is a critical factor in relation to potential changes in the immune system (Kick et al., 2012), intestinal barrier function and absorption (Wijtten et al., 2011), and the endocrine system (Zhu et al., 2012). Furthermore, a recent report demonstrated that weaning can also induce oxidative stress (Zhu et al., 2012). Generally, oxidative stress is considered to be the result of an imbalance between the production of reactive oxygen species (ROS) and the biological ability to clear reactive intermediates (Pi et al., 2010; Reuter et al., 2010). This imbalance damages cellular macromolecules and, when it remains out of control, can lead to irreparable oxidative injury and cell death, which has the potential to impact the whole organism’s function and survival (Yin et al., 2013).

A recent study has confirmed that weaning plays an important role in postweaning oxidative stress and free radical metabolism (Zhu et al., 2012). Oxidative damage is usually due to high concentrations of ROS, whereas a low or transient level of ROS acts to activate cellular proliferation or survival signaling pathways (Buetler et al., 2004; Finkel, 2003). For example, ROS are used by the immune system to attack and kill pathogens (Segal, 2005) and can induce the synthesis of activator protein 1, which is a key regulator of cell growth and proliferation (Kerr et al., 1992; Shaulian and Karin, 2002]).

We hypothesized that weaning oxidative stress plays a role in feedback regulation, which can activate signaling pathways and regulate antioxidant gene expression and thus promote the development of an antioxidant system. Therefore, the aim of the present study was to investigate oxidative injury and the development of an antioxidant system after weaning in piglets and then to evaluate whether there is a need for supplementation with antioxidants before weaning.


MATERIALS AND METHODS

Experimental Design

This study was conducted according to the guidelines of the Declaration of Helsinki, and all procedures involving animal subjects were approved by the Animal Welfare Committee of the Institute of Subtropical Agriculture, Chinese Academy of Sciences (Yin et al., 2010). A total of 40 piglets (Landrace× Large White, similar weight [2.38 kg] and health condition) were weaned at 14 d of age and randomly slaughtered using electrical stunning at 0 (w0d), 1 (w1d), 3 (w3d), 5 (w5d), or 7 d (w7d; n = 8)(Zhang et al., 2013). After weaning, piglets were fed with creep feed (Artificial milk 101, Anyou Feed, Changsha City, China) instead of breast milk (Yao et al., 2008). The experiment had a randomized design, and all piglets were allowed free access to water throughout the experimental period. Before slaughter, blood was obtained from a jugular vein in a collection tube coated with heparin sodium. Plasma was separated by centrifugation at 3,500 × g for 15 min at 4°C and stored at –20°C until the determination of superoxide dismutase (SOD), catalase, glutathione peroxidase (GSH-Px), malondialdehyde (MDA), protein carbonyl, and 8-hydroxydeoxyguanosine (8-OHdG; Wu et al., 2013). After electrical stunning, piglets were harvested, and the small intestine was rinsed thoroughly with ice-cold physiological saline solution (Tan et al., 2009). Midjejunum and midileum segments (2 g) were dissected at approximately 45% and 85% of the small intestinal length. Subsequently, the collected samples were immediately frozen in liquid nitrogen and stored at –70°C for subsequent gene expression and Western blot analysis. In this study, the jejunum and ileum were selected as target organs because many studies have confirmed that the small intestine is one of the most important sites for oxidative stress (Gu et al., 2012; Khan et al., 2012) and intestinal barrier function and absorption are strongly impaired under weaning stress (Wijtten et al., 2011).

Measurement of Plasma Oxidant Injury Products

The plasma base oxidation product MDA, protein carbonyl, and 8-OHdG were determined using ELISA kits in accordance with the manufacturer’s instructions (Shen et al., 2012; Cell Biolabs, San Diego, CA).

Measurement of Plasma Antioxidant Enzyme Activities

Plasma superoxide dismutase was measured using an ELISA kit in accordance with the manufacturer’s instructions (Cell Biolabs). The superoxide dismutase activity assay uses a xanthine/xanthine oxidase system to generate O2, the included chromagen produces a water-soluble formazan dye on reduction by O2, and the activity of SOD is determined in terms of the inhibition of chromagen reduction. Glutathione peroxidase and catalase activities were measured using spectrophotometric kits in accordance with the manufacturer’s instructions (Nanjing Jiangcheng Biotechnology Inst., Nanjing, China).

Quantification of mRNA by Real-Time PCR Analysis

Total RNA was isolated from the liquid-nitrogen-pulverized jejunum and ileum with TRIzol reagent (Invitrogen, Carlsbad, CA) and then treated with DNase I (Invitrogen) according to the manufacturer’s instructions. Synthesis of the first strand (cDNA) was performed with Oligo (dT)20 and Superscript II reverse transcriptase (Invitrogen).

Primers were designed with Primer 5.0 (PREMIER Biosoft Int., Palo Alto, CA) according to the gene sequence of the pig to produce an amplification product (Table 1). β-Actin was used as a housekeeping gene to normalize target gene transcript levels. The resulting cDNA was diluted and used as a PCR template to evaluate gene expression. The reaction was performed in a volume of 10 μL (ABI Prism 7700 Sequence Detection System; Applied Biosystems, Foster City, CA). Real-time PCR was performed according to our previous study (Ren et al., 2011). Briefly, 1 μL cDNA template was added to a total volume of 10 μL containing 5 μL SYBR Green mix, 0.2 μL Rox, 3 μL δH2O, and 0.4 µmol/L each of forward and reverse primers. We used the following protocol: 1) predenaturation program (10 s at 95°C), 2) amplification and quantification program, repeated for 40 cycles (5 s at 95°C, 20 s at 60°C), and 3) melting curve program (60°C–99°C with a heating rate of 0.1°C/s and fluorescence measurement). The relative expression was expressed as a ratio of the target gene to the control gene using the formula 2−(ΔΔCt), where ΔΔCt = (CtTarget − Ctβ-actin)treatment − (CtTarget − Ctβ-actin)control. The relative expression was normalized and expressed as a ratio to the expression in the preweaning (w0d) piglets. Therefore, the relative expression of target genes on w0d was 1.0. Relative gene expression represented the comparison vs. w0d and is reported as a fold change from the w0d value.


View Full Table | Close Full ViewTable 1.

Primers used for quantitative reverse transcription PCR1

 
Name of target gene Accession No. Nucleotide sequence of primers (5´–3´) Size, bp
β-Actin DQ845171.1 F: CTGCGGCATCCACGAAACT R: AGGGCCGTGATCTCCTTCTG 147
MnSOD NM_214127 F: GGACAAATCTGAGCCCTAACG R: CCTTGTTGAAACCGAGCC 159
CuZnSOD NM_001190422 F: CAGGTCCTCACTTCAATCC R: CCAAACGACTTCCASCAT 255
GPx1 NM_214201 F: TGGGGAGATCCTGAATTG R: GATAAACTTGGGGTCGGT 183
GPx4 NM_214407.1 F: GATTCTGGCCTTCCCTTGC R: TCCCCTTGGGCTGGACTTT 172
Ucp2 NM_214289 F: CCAATGTCGCTCGTAATG R: TGGCAGGGAAGGTCATC 109
p53 NM_213824 F: CTGCTTCCTGAAAACAACC R: AAGGGACAAAGGACGACA 199
1F = forward; R = reverse. MnSOD = manganese-containing superoxide dismutase; CuZnSOD = copper- and zinc-containing superoxide dismutase; GPx1 = glutathione peroxidase 1; GPx4 = glutathione peroxidase 4; Ucp2 = uncoupling protein 2; p53 = tumor protein 53. All these primer sequences were designed on the basis of the sequence corresponding to the accession number described above.

Nuclear Protein Extraction and Western Blot Analysis

Western blots were performed using antibodies specific to lamin B, nuclear factor erythroid 2-related factor 2 (Nrf2), and transcription factor 65 (p65; Abcam Inc., Changsha City, China). Briefly, jejunal and ileal nuclear protein extraction used nuclear and cytoplasmic extraction reagents in accordance with the manufacturer’s instructions (Thermo Fisher Scientific, Waltham, MA). Equal amounts of proteins obtained from the nuclear fractions were separated by a reducing SDS-PAGE electrophoresis (Xiao et al., 2013a, b; Wu et al., 2010). The proteins were transferred onto polyvinylidene fluoride membranes (Millipore, Wuhan City, China) and blocked with 5% nonfat milk in Tris-Tween buffered saline buffer (20 mM Tris, pH 7.5, 150 mM NaCl, and 0.1% Tween-20) for 3 h. The primary antibodies were incubated overnight at 4°C; the horseradish peroxidase-conjugated secondary antibodies were subsequently incubated for 1 h at room temperature before the blots were developed using Alpha Imager 2200 software (Alpha Innotech Corporation, Wuhan City, China). We digitally quantified the resultant signals and normalized the data to the lamin B abundance. Lamin B was used as an internal loading control for nuclear protein fractions.

Statistical Analysis

Statistical analyses were performed with the SAS software package (version 9.2; SAS Inst. Inc., Cary, NC). Data were subjected to PROC MIXED analysis of variance-covariance followed by Tukey’s multiple comparisons test. Data are expressed as the mean ± standard error of the mean. Values with different superscript letters are significantly different (P < 0.05), whereas values with the same or no superscript letters are not significantly different (P > 0.05).


RESULTS

Early Weaning Caused Lipid, Protein, and DNA Oxidant Injury

Plasma oxidative injury products are shown in Fig. 1. The plasma MDA level in the w0d group was 127.33 ± 13.98 pmol/mg, but this value gradually increased to a significant peak at w3d (225.92 ± 21.44 pmol/mg; P < 0.05), and thereafter the curve showed a downward trend (P < 0.05; Fig. 1). Piglets clearly suffered serious lipid oxidative injury at 3 d after weaning, and then lipid peroxidation gradually alleviated. We also detected the product of protein oxidative injury (Fig. 1B). Protein carbonyl is the most common product of protein oxidation in biological samples. In our study, the plasma protein carbonyl level was significantly increased (P < 0.05) at w1d (24.99 ± 0.83 nmol/mg), w3d (25.77 ± 0.73 nmol/mg), and w5d (26.60 ± 0.73 nmol/mg) compared with w0d (22.18 ± 0.74 nmol/mg). Furthermore, compared with w0d and w1d, the plasma 8-OHdG levels were higher at w3d (P > 0.05), w5d (P > 0.05), and w7d (P < 0.05). However, the curve did not show a downward trend up to 7 d, which suggests that DNA oxidative injury lasts longer than lipid and protein oxidative injury caused by early weaning stress.

Figure 1.
Figure 1.

Plasma oxidant injury products obtained 0, 1, 3, 5, and 7 d after weaning (w0d, w1d, etc.). MDA: malondialdehyde; 8-OHdG: 8-hydroxydeoxyguanosine.

 

Early Weaning Reduced Plasma Antioxidant Enzymes Activities

As seen in Fig. 2, compared with the w0d results, plasma superoxide dismutase activity was decreased (P > 0.05) at w1d and then significantly recovered on 3, 5, and 7 d (P < 0.05) after weaning. Although catalase is a key antioxidant enzyme, there was no difference in plasma catalase activity (P > 0.05) among the 5 time points. Early weaning stress significantly reduced GSH-Px activity at 3 d (P < 0.05) after weaning compared with the other groups.

Figure 2.
Figure 2.

Plasma antioxidant enzymes activities obtained 0, 1, 3, 5, and 7 d after weaning (w0d, w1d, etc.). SOD: superoxide dismutase (U/ml); GSH-Px: glutathione peroxidase (U/mL).

 

Early Weaning Stress Altered the Expression of Antioxidant-Related Genes in the Ileum and Jejunum

To understand the mechanism of the changes in antioxidant enzymes, the expression of several antioxidant relative genes was investigated during the weaning period by PCR analysis. As shown in Fig. 3, jejunal copper- and zinc-containing superoxide dismutase (CuZnSOD), manganese-containing superoxide dismutase (MnSOD), glutathione peroxidase 1 (GPx1), and glutathione peroxidase 4 (GPx4) mRNA levels showed similar changes. After weaning, the mRNA levels of all these genes were decreased, and significant decreases were seen at 3 d. Abundances of CuZnSOD, MnSOD, GPx1, and GPx4 mRNA were 0.18-fold (P < 0.05), 0.40-fold (P < 0.05), 0.33-fold (P < 0.05), and 0.21-fold (P < 0.05) less at w3d and decreased 0.30-fold (P > 0.05), 0.37-fold (P < 0.05), 0.46-fold (P > 0.05), and 0.33-fold (P < 0.05) at w5d compared with those at w0d, respectively. At 7 d, CuZnSOD, MnSOD, and GPx1 mRNA levels were slightly recovered, but this change was not significant (P > 0.05). However, we did not observe similar results in the ileum. Compared with the value at w0d, the MnSOD mRNA level was slightly decreased (P > 0.05) at w1d and then gradually recovered (P > 0.05). Interestingly, early weaning stress did not suppress GPx4 gene expression, and the results showed that GPx4 mRNA levels in the ileum were significantly higher at w3d, w5d, and w7d than that at w0d and w1d (P < 0.05). The abundance of uncoupling protein 2 (Ucp2) mRNA was 1.99-fold (P < 0.05) higher at w5d in the jejunum, whereas it was 0.66-fold (P < 0.05), 0.69-fold (P < 0.05), 0.71-fold (P < 0.05), and 0.61-fold (P < 0.05) less compared with w0d in the ileum. Expression of tumor protein 53 (p53) was 1.95-fold (P < 0.05), 2.38-fold (P < 0.05), and 2.39-fold (P < 0.05) higher at w3d, w5d, and w7d than that at w0d and w1d in the ileum.

Figure 3.
Figure 3.

Relative gene expression of selected genes in jejunum and ileum. MnSOD = manganese-containing superoxide dismutase; CuZnSOD = copper- and zinc-containing superoxide dismutase; GPx1 = glutathione peroxidase 1; GPx4 = glutathione peroxidase 4; Ucp2 = uncoupling protein 2; p53 = tumor protein 53; w0d to w7d: 0 to 7 d after weaning.

 

Expression Level of Nuclear p65 and Nrf2 Proteins

In the ileum, we found that p65 decreased at 3, 5, and 7 d (P < 0.05) and Nrf2 was suppressed at 5 and 7 d (P < 0.05; Fig. 4), whereas similar results were not seen in the jejunum. The nuclear Nrf2 level in the jejunum was significantly higher at w3d and w7d than at other time points (P < 0.05). Meanwhile, there were no differences in the jejunal p65 level (P > 0.05).

Figure 4.
Figure 4.

Nuclear p65 and Nrf2 levels in the jejunum and ileum. p65: transcription factor p65; Nrf2: nuclear factor erythroid 2-related factor 2; w0d to w7d: 0 to 7 d after weaning.

 


DISCUSSION

Weaning is considered to be one of the top stressors that animals may experience (Kelley, 1980). Weaning-induced immune response (Liu et al., 2009; Kick et al., 2012), intestinal dysfunction (Wijtten et al., 2011; Wu et al., 2012), and endocrine disorders (Zhu et al., 2012) have been studied. The results of the present experiment indicated that early weaning can cause oxidative injury of lipids, protein, and DNA, as well as declines in intestinal antioxidant enzyme activities under p65 and Nrf2 signals.

To determine the oxidative injury caused by early weaning, plasma MDA, protein carbonyl, and 8-OHdG levels were studied. Malondialdehyde is the most common product of lipid peroxidation (Lapenna and Cuccurullo, 1993; Pirinccioglu et al., 2010), and its level can directly reflect the degree of lipid oxidative injury. In our study, piglets suffered lipid oxidative injury at 3d after weaning, and lipid peroxidation then gradually diminished. In contrast to the results of Zhu et al. (2012), serum MDA level only increased at 14 d after weaning. This difference may be caused by the weaning time, which was 21 d in their study, and the early-weaned piglets in our study may be more susceptible to weaning stress. Proteins and DNA are also significant targets of oxidative attack (Pirinccioglu et al., 2010), and modification of these molecules can increase the risk of mutagenesis (Reuter et al., 2010). In our study, early weaning stress increased plasma protein carbonyl and 8-OHdG levels. Overall, lipid peroxidation mainly appeared on the third day, protein oxidation occurred from 1 to 5 d after weaning, and DNA oxidative injury mainly appeared after 3 d after weaning. Thus, early weaning stress caused lipid, protein, and DNA oxidative injury, which are characterized by an increase in intracellular oxidative stress due to a progressive decrease in intracellular ROS scavenging (Minelli et al., 2009; Reuter et al., 2010) in piglets, and these 3 molecules exhibited different oxidative susceptibilities and durations: protein is the most susceptible to oxidative stress, and DNA has a longer oxidative duration in piglets under weaning stress.

The complex system of antioxidant enzymes (e.g., SOD, GSH-Px, and catalase) serves to protect the organism against the harmful prooxidants (Minelli et al., 2009). Superoxide dismutase provides the efficient dismutation of O2 into H2O2, which is scavenged by GSH-Px and catalase (Yin et al., 2013). In our study, we found that plasma SOD activity decreased 1 d after weaning and then recovered at 3, 5, and 7 d. In contrast to the results of Zhu et al. (2012), our SOD activity curve exhibited a significant upward trend at 7 d after weaning. We also found that the expression of SOD-related genes in the jejunum and ileum followed a time course that was consistent with the plasma SOD activity curve. However, jejunal CuZnSOD and MnSOD mRNA levels were significantly decreased only at 3 d, and the increase at 7 d was insignificant. In addition, we also failed to observe a consistent relationship between expression of SOD-related genes in the ileum and plasma SOD activity. Therefore, we speculated that plasma SOD activity is not only activated by the expression of SOD-related genes but also mediated by other factors, such as plasma zinc and copper levels (Chakraborty et al., 2007). The biochemical function of GSH-Px is to reduce lipid hydroperoxides to their corresponding alcohols and to reduce free hydrogen peroxide to water (Dalvi et al., 2012). In the present study, early weaning stress suppressed plasma GSH-Px activity at 3 d in postweaning piglets, which was consistent with the expression of GPx1 and GPx4 in the jejunum at 3 d. Several studies have demonstrated that the upregulation of the GPxs gene can induce the secretion of GSH-Px (Higashi et al., 2013). Therefore, the decrease in GSH-Px activity was associated with downregulation of GPxs genes, which was caused by early weaning stress in our study.

Uncoupling protein 2, a member of the larger family of mitochondrial anion carrier proteins, is referred to as the mitochondrial proton leak transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane (Tian et al., 2012). Overexpression of Ucp2 has antiapoptotic properties by inhibiting ROS-mediated apoptosis, and its downregulation can improve the efficiency of ATP synthesis (Mattiasson and Sullivan, 2006). In the present study, early weaning may play the antioxidant role in the jejunum and enhance the ATP synthesis in the ileum. Tumor protein 53 is a redox-active transcription factor that organizes and directs cellular responses in the face of a variety of stresses that lead to genomic instability (Cano et al., 2009). Activation of p53 can induce a range of responses, including cell cycle arrest, DNA repair, apoptosis, and senescence (Lee et al., 2013). The relative functions of p53 depend at least partly on the cellular p53 concentration, as well as on other factors, such as p53 subcellular localization and phosphorylation status (Zhu et al., 2012). In this study, early weaning upregulated the expression of p53, which may involve the development of the antioxidant system.

To further explain the changes in plasma oxidation injury products, antioxidant enzymes, and the development of antioxidant-related genes during the weaning period, we also explored signaling pathways that included p65 and Nrf2. In our lab, we have observed that both p65 and Nrf2 signals play important roles in oxidative stress and initiate large numbers of antioxidant genes after translocation into the nucleus (Yin et al., 2013). Under homeostatic or nonstress conditions, p65 and Nrf2 are sequestered in the cytosol via inhibitory proteins, such as IκBs and Keap1 (Stewart et al., 2003; Gloire et al., 2006). However, when cells are exposed to oxidative stress and excessive ROS, the oxidation, conjugation, or phosphorylation of key cysteine residues in the inhibitory proteins would increase (Takada and Aggarwal, 2004; Zhang et al., 2013), resulting in the accumulation of free p65 and Nrf2 in the cytosol and an increase in the translocation of p65 and Nrf2 into the nucleus (Hayden and Ghosh, 2004) to regulate the expression of multiple target genes (Hayden and Ghosh, 2004). Recent studies have demonstrated that early weaning can induce oxidative stress in piglets (Zhu et al., 2012), so we speculate that weaning may enhance nuclear p65 and Nrf2 levels. Conversely, we found that both nuclear p65 and Nrf2 exhibited a downward trend after weaning in the ileum, and the nuclear Nrf2 level in the jejunum at w3d and w7d was significantly higher than that at other time points, which may be due to tissue differences. Therefore, it seems that early weaning suppressed p65 and Nrf2 signals. A possible mechanism is that excessive ROS generated by early weaning prevents phosphorylation and the subsequent degradation of IκBs and Keap1 (Kil et al., 2008) and promotes proteasomal degradation of Nrf2 and p65.

In conclusion, early weaning stress caused lipid, protein, and DNA oxidative injury, and these 3 molecules exhibited different oxidative susceptibilities. Early weaning may suppress p65 and Nrf2 signals, which might feedback-regulate antioxidant gene expression and promote the development of an antioxidant system. Further studies should be conducted to more completely determine the mechanism regulating the development of antioxidant system after weaning.

 

References

Footnotes


Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.