View Full Table | Close Full ViewTable 1.

Primers used for quantitative reverse transcription PCR1

 
Name of target gene Accession No. Nucleotide sequence of primers (5´–3´) Size, bp
β-Actin DQ845171.1 F: CTGCGGCATCCACGAAACT R: AGGGCCGTGATCTCCTTCTG 147
MnSOD NM_214127 F: GGACAAATCTGAGCCCTAACG R: CCTTGTTGAAACCGAGCC 159
CuZnSOD NM_001190422 F: CAGGTCCTCACTTCAATCC R: CCAAACGACTTCCASCAT 255
GPx1 NM_214201 F: TGGGGAGATCCTGAATTG R: GATAAACTTGGGGTCGGT 183
GPx4 NM_214407.1 F: GATTCTGGCCTTCCCTTGC R: TCCCCTTGGGCTGGACTTT 172
Ucp2 NM_214289 F: CCAATGTCGCTCGTAATG R: TGGCAGGGAAGGTCATC 109
p53 NM_213824 F: CTGCTTCCTGAAAACAACC R: AAGGGACAAAGGACGACA 199
1F = forward; R = reverse. MnSOD = manganese-containing superoxide dismutase; CuZnSOD = copper- and zinc-containing superoxide dismutase; GPx1 = glutathione peroxidase 1; GPx4 = glutathione peroxidase 4; Ucp2 = uncoupling protein 2; p53 = tumor protein 53. All these primer sequences were designed on the basis of the sequence corresponding to the accession number described above.