Search
Author
Title
Vol.
Issue
Year
1st Page

Journal of Animal Science - Animal Nutrition

The effects of active dried and killed dried yeast on subacute ruminal acidosis, ruminal fermentation, and nutrient digestibility in beef heifers1

 

This article in JAS

  1. Vol. 92 No. 2, p. 724-732
     
    Received: Aug 26, 2013
    Accepted: Dec 07, 2013
    Published: November 24, 2014


    2 Corresponding author(s): karen.beauchemin@agr.gc.ca
 View
 Download
 Share

doi:10.2527/jas.2013-7072
  1. D. Vyas*,
  2. A. Uwizeye*,
  3. R. Mohammed*,
  4. W. Z. Yang*,
  5. N. D. Walker and
  6. K. A. Beauchemin 2
  1. Agriculture and Agri-Food Canada, Lethbridge Research Center, Lethbridge, AB T1J 4B1, Canada
    AB Vista Feed Ingredients, Marlborough, Wiltshire, SN8 4AN, UK

Abstract

The study addressed the importance of yeast (Saccharomyces cerevisiae) viability for reducing the incidence of subacute ruminal acidosis (SARA) and improving total tract nutrient digestibility in beef heifers. Six ruminally cannulated beef heifers (680 ± 50 kg BW) were used in a replicated 3 × 3 Latin square design and were fed a diet consisting of 40% barley silage, 10% chopped grass hay, and 50% barley grain-based concentrate (DM basis). Treatments were 1) no yeast (Control), 2) active dried yeast (ADY; 4 g providing 1010 cfu/g; AB Vista, Marlborough, UK), and 3) killed dried yeast (KDY; 4 g autoclaved ADY). The treatments were directly dosed via the ruminal cannula daily at the time of feeding. The periods consisted of 2 wk of adaptation (d 1 to 14) and 7 d of measurements (d 15 to 21). Ruminal pH was continuously measured (d 15 to 21) using an indwelling system. Ruminal contents were sampled on d 15 and 17 at 0, 3, 6, 9, and 12 h after feeding. Total tract nutrient digestibility was measured using an external marker (YbCl3) from d 15 to 19. No treatment difference was observed for DMI (P = 0.86). Yeast supplementation (ADY and KDY) tended to increase total tract digestibility of starch (P = 0.07) whereas no effects were observed on digestibility of other nutrients. Both ADY and KDY elevated minimum (P < 0.01) and mean ruminal pH (P = 0.02) whereas no effects were observed on maximum pH (P = 0.12). Irrespective of its viability, yeast supplementation was effective in reducing time that ruminal pH was below 5.8 (P < 0.01) and 5.6 (P < 0.01). No treatment differences were observed for the ruminal VFA profile and lactate concentration. No treatment differences were observed on the relative population size of Streptococcus bovis, Fibrobacter succinogenes, and Megasphaera elsdenii (P > 0.10); however, the proportion of Ruminococcus flavefaciens in solid fraction of digesta was greater with KDY (P = 0.05). The study demonstrates the positive effects of yeast, irrespective of its viability, in reducing the severity of SARA. However, further studies are required to evaluate the importance of yeast viability for other dietary conditions, particularly when the risk of acidosis is high.



INTRODUCTION

Active dried yeast (ADY) is used in ruminant nutrition as a feed additive to improve feed efficiency and performance and, at the same time, to prevent health disorders (McAllister et al., 2011). Yeast is particularly useful in high-producing ruminants whose digestive microbial balance can be altered by high-dietary energy input. Active dried yeast can survive and remain metabolically active in the gut (Kung et al., 1997), and therefore it can exert probiotic effects by interacting with the autochthonous microbial species responsible for enhancing feed digestion. Until now, the most consistent positive effects of ADY have been reported for ruminal microbial activity in young ruminants, stabilizing ruminal pH, and preventing subacute ruminal acidosis (SARA) as well as stimulating growth and activity of fiber-degrading bacteria (Chaucheyras-Durand et al., 2008).

Despite beneficial effects of ADY, responses have been variable possibly due to the strain of yeast and differences in cell viability during production, storage, and delivery of different yeast products (Sullivan and Bradford, 2011). Moreover, it is not known whether the viability of the ADY is critical for its beneficial effects. Previous studies have shown that autoclaved cells of Saccharomyces cerevisiae (Oeztuerk, 2009) and Saccharomyces boulardii (Oeztuerk et al., 2005) can stimulate ruminal fermentation by providing nutrients contained within the cells (vitamins or other growth factors) to autochthonous microbiota (Opsi et al., 2012). Therefore, yeast may exhibit prebiotic effects in addition to the well-documented probiotic effects. Although there is some evidence of the beneficial effects of autoclaved yeast products, few studies have been conducted to evaluate the effects of the yeast’s viability on ruminal fermentation under in vivo conditions. Therefore, the objective of the current study was to compare ADY and autoclaved whole yeast for their effects on SARA, ruminal fermentation, and total tract nutrient digestibility in beef heifers.


MATERIALS AND METHODS

Animals were cared for and managed according to the guidelines of the Canadian Council on Animal Care (Ottawa, ON, Canada). Experimental procedures involving animals were approved by the Institutional Animal Care and Use Committee at the Lethbridge Research Centre.

Experimental Design, Animals, and Dietary Treatments

Six ruminally cannulated beef heifers (680 ± 50 kg) were used in a replicated 3 × 3 Latin square design. Animals were randomly assigned to 1) no yeast (Control), 2) ADY (4 g/d), or 3) killed dried yeast (KDY; 4 g/d). Yeast strain used was S. cerevisiae (AB Vista, Marlborough, Wiltshire, UK), and the viability of the preparation was checked before starting the experiment. Treatments were dosed via the rumen cannula daily at the time of feeding using a gelatin capsule (Torpac Inc., Fairfield, NJ) to ensure each animal received the full amount. Control animals received an empty capsule. Inactivation of ADY was achieved by grinding yeast cells in a Knifetec 1095 sample mill (Foss Tecator, Höganäs, Sweden) for 20 s followed by standard autoclaving for 20 min at 121°C and 103.4 kPa (BetaStar Corporation, Telford, PA). To test whether the inactivation was effective, 10 mg of autoclaved yeast was incubated at 30°C in yeast extract/peptone/dextrose liquid medium in a shaking incubator followed by plating 100 μL of inoculate from the liquid medium onto yeast extract/pepton/dextrose agar and for 3 d at 30°C (Oeztuerk et al., 2005). The mean number of yeast colonies detected on agar were 3.48 ± 0.88 × 1010 cfu/g for ADY and 2.86 ± 4.36 × 102 cfu/g for KDY. The counts of live cells observed in KDY were much less than the minimum dose suggested as being effective for ADY (Desnoyers et al., 2009).

The heifers were fed a basal diet consisting of 50:50 forage-to-concentrate ratio (DM basis; Table 1) formulated to meet the nutrient requirements of cattle weighing 600 kg and gaining 1.5 kg/d (NRC, 2000). Commercial pellets containing melengestrol acetate were top dressed to prevent heifers from manifesting estrus. The animals were fed for ad libitum intake once daily at 1100 h. They were housed in a ventilated tie-stall barn and had access to an open dry lot for exercise daily.


View Full Table | Close Full ViewTable 1.

Ingredient composition of the total mixed ration and melengestrol acetate (MGA) supplement

 
Item % of DM
Ingredient
    Barley silage1 40.0
    Chopped grass hay2 10.0
    Barley grain, dry rolled3 42.5
    Supplement4 5.0
        Canola meal 4.100
        Barley, ground 3.517
        Canola oil 0.057
        Limestone 0.300
        Salt 0.050
        Urea 0.400
        Molasses 1.500
        Vitamin E (500,000 IU/kg) 0.006
        Feedlot premix5 0.050
    MGA6 2.5
        MGA-100 premix 0.013
        Barley, ground 2.428
        Molasses, dried 0.057
        Flavoring, cattle 0.002
Chemical composition
    DM, % 50.7 ± 2.23
    OM, % of DM 91.8 ± 0.79
    CP, % of DM 12.4 ± 0.75
    NDF, % of DM 39.9 ± 4.23
    ADF, % of DM 19.5 ± 4.19
    Starch, % of DM 33.8 ± 4.48
1Composition (mean ± SD; % DM basis): 33.8 ± 2.14 DM, 88.9 ± 6.08 OM, 11.4 ± 1.36 CP, 55.2 ± 7.91 NDF, 30.3 ± 9.04 ADF, and 16.3 ± 1.73 starch.
2Composition (mean ± SD; % DM basis): 91.2 ± 0.62 DM, 93.4 ± 0.67 OM 6.47 ± 0.45 CP, 67.2 ± 4.79 NDF, 40.4 ± 0.86 ADF, and 3.66 ± 0.49 starch.
3Composition (mean ± SD; % DM basis): 91.9 ± 0.95 DM, 97.8 ± 0.16 OM 13.2 ± 1.26 CP, 20.2 ± 0.64 NDF, 5.97 ± 0.89 ADF, and 49.2 ± 6.83 starch.
4Composition (mean ± SD; % DM basis): 95.0 ± 0.69 DM, 63.3 ± 4.05 OM 18.2 ± 0.65 CP, 21.5 ± 4.19 NDF, 6.21 ± 0.52 ADF, and 42.3 ± 2.06 starch.
5Feedlot premix provided to diet DM an additional 14 g/kg Ca, 103 mg/kg Zn, 26 mg/kg Cu, 47 mg/kg Mn, 1 mg/kg I, 0.50 mg/kg Se, 0.33 mg/kg Co, 17,187 IU/kg vitamin A, 859 IU/kg vitamin D3, and 24 IU/kg vitamin E.
6Composition (mean ± SD; % DM basis): 91.6 ± 1.68 DM, 96.7 ± 0.48 OM 12.5 ± 1.48 CP, 15.8 ± 3.17 NDF, 6.57 ± 1.60 ADF, and 56.0 ± 3.28 starch.

Measurements

The length of each period was 3 wk, with a 14-d adaptation and 7-d measurement period. Each period was followed by a 7-d washout period to minimize carryover effects in the next treatment period. Daily intakes and refusals of the experimental diets for individual heifers were recorded. Samples of the total mixed ration and ingredients were collected weekly. Samples were composited and stored frozen until analyzed. Refusals were sampled daily, composited by week, and stored frozen at –20°C until determination of DM content and chemical composition. Body weight of each heifer was recorded at the start and the end of each period.

Ruminal pH was measured continuously for 7 d (d 15 to 21) using the Lethbridge Research Center Ruminal pH Measurement System (LRCpH; Dascor, Escondido, CA). The system was standardized (in pH 4 and pH 7 solutions) before insertion on the first day and then on removal on the last day. The shift in millivolt reading from the electrodes between the start and end standardizations was assumed to be linear and was used to convert millivolt readings to pH units as described by Penner et al. (2006). The pH was recorded every minute. The severity of SARA was determined using 2 pH thresholds: 5.8 for total SARA as described by Dohme et al. (2008) and 5.6 for severe SARA according to Nagaraja and Lechtenberg (2007).

At 0, 3, 6, 9, and 12 h after feeding on d 15 and 17, ruminal contents were sampled from cranial, caudal, dorsal, and ventral aspects of the rumen, composited, and divided into solid and liquid fractions by straining through a double layer of polyester monofilament fabric (Pecap 7-1180/59, mesh opening 1, 180 µm; Tetko Inc., Scarborough, ON, Canada). Five milliliters of filtered ruminal fluid was preserved by adding 1 mL of 25% (wt/vol) meta-phosphoric acid for VFA and lactic acid determination, and 5 mL of filtered ruminal fluid was preserved by adding 1 mL of 1% (wt/vol) sulfuric acid for NH3 determination. The samples were subsequently stored frozen at –20°C until analyzed. Five milliliters of filtered ruminal fluid was mixed with 10 mL of methyl green-formalin-saline solution for protozoa quantification. The samples were stored at room temperature in a dark place until analyzed.

Extraction of DNA and Quantitative PCR

Ruminal digesta samples collected at 0, 3, 6, 9, and 12 h on d 15 and 17 of each period were pooled by cow for each day before DNA extraction. A total of 72 ruminal digesta (36 solid phase and 36 liquid phase) samples were subjected to DNA extraction. Microbial DNA was extracted directly from the liquid phase of the ruminal contents, but the solid phase was first homogenized in a blender with chilled extraction buffer (100 mM Tris-HCl, 10 mM EDTA, and 0.15 M NaCl, pH 8.0) to release solid associated bacteria (Stevenson and Weimer, 2007). In brief, DNA was extracted from 25 mL of liquid phase and 25 g of solid phase of ruminal digesta using a series of wash steps with the extraction buffer followed by lysis of the microbial cells in a bead beater (B. Braun, Melsungen, Hesse, Germany), extraction with combinations of phenol/chloroform, and precipitation with isopropanol (Stevenson and Weimer, 2007). The DNA obtained was resuspended in TE buffer (10 mM Tris-HCl and 1 mM EDTA, pH 8.0) and its concentration measured by spectrophotometry (Nanodrop ND-1000; Thermo Scientific, Wilmington, DE). The DNA obtained was stored at –20°C in aliquots of 10 ng/μL (stock).

Quantitative real-time PCR assays were conducted using the DNA extracted from the liquid and solid phase of ruminal digesta, using POWER SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK), forward and reverse primers (25 pmol of each primer/reaction), and approximately 20 ng of template DNA in a final volume of 25 μL per reaction. Quantitative real-time PCR assays were conducted using Applied Biosystems Prism 7900 sequence detection system. Features of the primers used for quantitative PCR are shown in Table 2. The amplification conditions were 40 cycles of 95°C for 15 s and an annealing and extension period of 60 s (at 59°C for Megasphaera elsdenii, Fibrobacter succinogenes, and Streptococcus bovis and 60°C for Ruminococcus flavefaciens). The PCR product specificity was verified by melt denaturation, and PCR efficiency was calculated as the negative reciprocal of the slope of the line obtained by plotting cycle threshold versus log DNA concentrations of the standard dilution series. Standards for domain bacteria were prepared from bacterial DNA recovered from ruminal samples. The standards and the samples were run in triplicate. The relative population size of the target bacterium was determined as the ratio of the amplification of target taxon (e.g., M. elsdenii) 16S rRNA copy numbers to the amplification of the background obtained by amplifying the 16S rRNA gene with eubacterial primers (BAC338F and BAC805R). Details of these calculations, with corrections for PCR efficiency, are described by Stevenson and Weimer (2007). The standard efficiencies ranged from 1.88 to 1.89 for F. succinogenes, 1.93 to 1.94 for R. flavefaciens, 1.83 to 1.84 for S. bovis, and 1.90 to 1.95 for M. elsdenii.


View Full Table | Close Full ViewTable 2.

Features of primers used for quantitative PCR analysis

 
Gene Primers (5′-3′)1 Size2 Reference
Total bacteria BAC338F: ACTCCTACGGGAGGCAG
BAC805R: GACTACCAGGGTATCTAATCC
200 Yu et al. (2005)
Streptococcus bovis F: TTCCTAGAGATAGGAAGTTTCTTCGG
R: ATGATGGCAACTAACAATAGGGGT
127 Stevenson and Weimer (2007)
Megasphaera elsdenii F: AGATGGGGACAACAGCTGGA
R: CGAAAGCTCCGAAGAGCCT
79 Stevenson and Weimer (2007)
Fibrobacter succinogenes F: GCGGGTAGCAAACAGGATTAGA
R: CCCCCGGACACCCAGTAT
70 Stevenson and Weimer (2007)
Ruminococcus flavefaciens F: TGGCGGACGGGTGAGTAA
R: TTACCATCCGTTTCCAGAAGCT
71 Stevenson and Weimer (2007)
1Primer direction (F = forward; R = reverse).
2Amplicon size in bp.

Diet Digestibility

Total tract digestibility of nutrients was determined using an external marker. Eleven grams of YbCl3 solution (purity 37%), providing approximately 2.5 g of Yb, was administered in the rumen daily from d 8 to 19. A representative sample of the marker was retained each period for Yb analysis. Fecal samples (100 g wet weight) were collected from the rectum of each heifer 4 times daily at random hours over a 5-d period (d 15 to 19) to enable the collection of samples representative of the digesta flowing over a 24-h feeding cycle (total 20 samples were collected). Fecal samples were composited by heifer, dried at 55°C for 72 h in a forced-air oven, ground through a 1-mm screen, and analyzed for analytical DM, OM, NDF, ADF, starch, and Yb. Ytterbium was assumed to be completely indigestible and the digestibility of DM was calculated as follows:in which DMI (kg/d) was DM consumed on the same days that fecal samples were collected, Yb fed was measured in milligrams per day, Yb in feces was measured in milligrams per kilogram DM. Digestibility of OM, NDF, ADF, starch, and CP was calculated using the same approach.

Chemical Analysis

All chemical analysis was performed on each sample in duplicate, and when the coefficient of variation for replicate analysis was >5%, the analysis was repeated. Analytical DM content of the ground sample was determined by drying at 135°C for 2 h (method 930.15; AOAC, 2005) followed by hot weighing. The OM content was calculated as the difference between 100% and ash content (method 942.05; AOAC, 2005). The NDF and ADF contents were determined nonsequentially according to Van Soest et al. (1991) with heat-stable amylase and sodium sulfite used in the NDF procedure. The 1-mm ground samples were reground using a ball grinder (Mixer Mill MM2000; Retsch, Haan, Germany) for determination of N and starch. The CP (N × 6.25) content was determined by flash combustion with gas chromatography and thermal conductivity detection (Carlo Erba Instrumentals, Milan, Italy). Starch content was determined by enzymatic hydrolysis of α-linked glucose polymers as described by Rode et al. (1999) with modifications. Tubes containing samples were initially incubated in a water bath at 90°C and vortexed at 10, 20, and 30 min of incubation without the use of activated carbon. Amyloglucosidase (200 μL; Megazyme, Wicklow, Ireland) was added and tubes were vortexed immediately and twice subsequently at 30 and 60 min during 60°C incubation for 2 h. Samples were centrifuged at 29,000 × g for 15 min at 4°C. Glucose Color Reagent (300 μL; Diagnostic Chemicals, Charlottetown, PEI, Canada) was added and glucose was determined colorimetrically at 505 nm using a microtiter plate reader. Ruminal protozoa were quantified in duplicate using a counting chamber (Neubauer Improved Bright-Line counting cell, 0.1 mm depth; Hausser Scientific, Horsham, PA) and a light microscope. Concentrations of NH3 in filtered ruminal fluid were determined by the salicylate-nitroprusside-hypochlorite method, using a flow injection analyzer (Sims et al., 1995). Concentrations of VFA and lactic acid in filtered ruminal fluid were quantified using gas chromatography as described earlier (Chung et al., 2011).

Statistical Analysis

Data analyses were conducted on measurements collected during d 15 to 21. Daily average ruminal pH (mean, minimum, maximum, and range, the difference between minimum and maximum) were analyzed using the mixed model procedure of SAS (PROC MIXED; SAS Inst. Inc., Cary, NC) to account for the effects of square, animal within square, period, and treatment (Control, ADY, and KDY). Treatment was considered a fixed effect; square, period, and animal within square were considered as random effects. Sampling time was considered a repeated measure.

Data for ruminal pH bouts below the threshold values were summarized by day and the total bout duration, the total area (pH units × min, defined as area under curve [AUC]), and the frequency of daily bouts (number/d) were analyzed. The long bouts of SARA under the pH threshold of 5.8 and 5.6 for more than 3 h were used to estimate the frequency of aggressive SARA.

The restricted maximum likelihood method was used for estimating the variance components. Denominator degrees of freedom were estimated using the Kenward-Roger’s option in the model statement. Time-series covariance structure was modeled using the options of autoregressive order-one, compound symmetry, and unstructured order-one. The lowest Akaike and Bayesian information criteria were considered to select the best time-series covariance structures. Data are presented as least squares means ± SEM. Statistical significance was declared at P ≤ 0.05 and trends were discussed when 0.05 < P ≤ 0.10.


RESULTS

Dry Matter Intake and BW

Dry matter intake, as kilograms per day and as percentage of BW daily, were similar for all the treatments (P = 0.86; Table 3). Likewise, no treatment effects were observed on average and final BW (P > 0.10; Table 3).


View Full Table | Close Full ViewTable 3.

Dry matter intake and BW of beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Variable Treatment
SEM P-value
Control1 ADY KDY
DMI, kg/d 11.3 11.3 11.7 0.73 0.86
DMI, % of BW 1.51 1.50 1.57 0.10 0.86
BW, kg 744 752 748 34.1 0.89
Initial BW, kg 735 741 738 35.9 0.95
Final BW, kg 754 764 758 32.8 0.82
Change of BW, kg 18.5 23.5 20.3 6.51 0.86
1Control = no yeast.

Ruminal pH Profile

Irrespective of its viability, ruminal pH profile was affected by yeast supplementation (Table 4). Heifers receiving yeast treatments, ADY and KDY, experienced greater average daily mean (P = 0.02) and minimum pH (P < 0.01) whereas no effects were observed for maximum ruminal pH (P = 0.12) as compared to the Control. Despite cows on both yeast treatments having elevated pH profiles, only those fed the KDY treatment (P = 0.02) differed from the Control for pH range (i.e., daily average maximum pH minus daily minimum pH). Heifers fed either yeast product had reduced (P ≤ 0.01) total duration of SARA (pH < 5.8 and 5.6) and tended to have less AUC below pH 5.6 (P = 0.09) indicating a less acidic environment compared with heifers receiving no yeast supplementation. Likewise, Control heifers had more (P = 0.05) frequent bouts of SARA (pH < 5.8) and experienced more (P = 0.01) frequent long bouts (≥3 h) of ruminal pH below 5.8 (P = 0.01) compared with heifers receiving diets supplemented with ADY and KDY.


View Full Table | Close Full ViewTable 4.

Ruminal pH profile of beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Variable Treatment
SEM P-value
Control1 ADY KDY
Mean pH 6.06b 6.28a 6.26a 0.121 0.02
Minimum pH 5.48b 5.65a 5.67a 0.103 <0.01
Maximum pH 6.74 6.84 6.77 0.054 0.12
Range in pH2 1.27a 1.19ab 1.10b 0.062 0.02
Ruminal pH < 5.8
    Duration of day,3 h/d 7.03a 3.55b 3.66b 2.161 <0.01
    AUC,4 pH × min/d 110 71 47 52.9 0.19
    Bout frequency, no./d 9.2 a 4.9b 6.3b 1.58 0.05
    Long bout (>3 h) frequency, no./d 0.69a 0.25b 0.33b 0.298 0.01
Ruminal pH < 5.6
    Duration of day, h/d 4.41a 2.47b 1.91b 1.399 <0.01
    AUC, pH × min/d 42 37 14 13.5 0.09
    Bout frequency, no./d 7.3 4.2 4.4 1.72 0.07
    Long bout (>3 h) frequency, no./d 0.44 0.13 0.11 0.224 0.12
a,bValues within a row with different letters differ (P ≤ 0.05).
1Control = no yeast.
2Range = maximum ruminal pH – minimum ruminal pH.
3Subacute ruminal acidosis measured as duration below the pH threshold (5.6 or 5.8).
4AUC =area under curve.

Ruminal Fermentation Characteristics

No treatment effects were observed for the total and individual VFA concentrations (Table 5). Similar responses were observed for both mean and maximum ruminal lactate concentrations. However, irrespective of its viability, yeast supplementation tended to increase NH3–N concentrations (P = 0.08). Total VFA and NH3–N concentrations were affected by sampling time (P < 0.01), but no treatment × hour interactions were observed.


View Full Table | Close Full ViewTable 5.

Ruminal fermentation characteristics of beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Variable Treatment
SEM P-value
Control1 ADY KDY Treatment Hour Treatment × hour
Total VFA, mM 104 102 106 5.44 0.89 <0.01 0.25
Individual VFA, mol/100 mol
    Acetate (A) 63.5 63.4 63.1 1.02 0.96 <0.01 0.06
    Propionate (P) 18.7 18.8 18.3 0.96 0.86 <0.01 0.61
    Isobutyrate 1.0 1.0 1.0 0.03 0.85 <0.01 0.96
    Butyrate (B) 12.0 12.2 12.8 0.48 0.47 0.22 0.68
    Valerate 1.78 1.73 1.80 0.07 0.76 <0.01 0.59
    Isovalerate 1.97 1.88 1.92 0.09 0.77 0.04 0.46
    Caproate 1.03 0.99 1.13 0.09 0.39 <0.01 0.85
Lactate, mM
Mean 0.17 0.06 0.08 0.07 0.46 0.07 0.68
Maximum 0.32 0.10 0.14 0.14 0.44 0.07 0.68
A:P ratio 3.55 3.47 3.55 0.23 0.95 <0.01 0.54
(A + B):P ratio 4.21 4.14 4.27 0.28 0.90 <0.01 0.58
NH3–N, mM 6.66 8.39 7.55 0.81 0.08 <0.01 0.81
Total protozoa, ×105 cells/mL 7.4 6.9 7.1 0.87 0.92 <0.01 0.83
1Control = no yeast.

Microorganisms

No treatment effects were observed on total protozoal counts (P = 0.92; Table 5). Most of the protozoal population was identified as Entodinium. Yeast supplementation had no effects on the relative abundance of S. bovis, M. elsdenii, and F. succinogenes (P > 0.10). However, a treatment × phase interaction (P = 0.01) was observed for the relative abundance of R. flavefaciens with greater response observed with KDY in the solid fraction of digesta as compared to ADY and Control. The relative abundance of R. flavefaciens, M. elsdenii, and S. bovis was greater in the solid fraction as compared to liquid fraction of ruminal contents (P < 0.01; Table 6)


View Full Table | Close Full ViewTable 6.

Relative population size (percentage of target species relative to total bacterial content) of rumen bacteria in beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Ruminal bacteria Liquid
Solid
SEM P-value
Control1 ADY KDY Control ADY KDY Treatment Phase Interaction
Megasphaera elsdenii (×10–2) 0.5 0.4 0.5 1.3 0.7 0.7 0.32 0.63 <0.01 0.21
Streptococcus bovis 0.02 0.02 0.02 0.05 0.08 0.08 0.012 0.12 <0.01 0.30
Fibrobacter succinogenes 0.87 0.83 0.91 0.89 0.81 0.76 0.114 0.91 0.37 0.43
Ruminococcus flavefaciens 2.1c 1.9c 2.0c 7.7b 7.3b 9.7a 0.47 0.05 <0.01 0.01
a,bValues within a row with different letters differ (P ≤ 0.05).
1Control = no yeast.

Apparent Total Tract Digestibility

Supplementation with yeast, both ADY and KDY, had no effect on apparent total tract nutrient digestibility (Table 7) although it tended to increase starch digestibility (P = 0.07) and numerically increased both DM (P = 0.16) and OM digestibility (P = 0.20).


View Full Table | Close Full ViewTable 7.

Apparent total tract digestibility of nutrients for beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Nutrient Treatment
SEM P-value
Control1 ADY KDY
DM, % 58.9 60.9 63.5 1.43 0.16
OM, % 61.0 62.9 65.6 1.55 0.20
CP, % 48.9 48.8 52.0 2.37 0.36
NDF, % 37.2 39.8 42.1 1.96 0.38
ADF, % 43.5 47.1 48.2 1.49 0.17
Starch, % 89.5 91.1 93.8 1.08 0.07
1Control = no yeast.


DISCUSSION

Although the effects of ADY on ruminal fermentation have been extensively studied, this study represents the first direct evidence of the efficacy of S. cerevisiae supplemented as KDY in improving the ruminal pH and reducing the duration of SARA in beef heifers. The study was designed as a Latin square, but carryover effects should not have influenced results on ruminal fermentation because of the 7-d washout period and limited ability of live yeast to multiply and remain viable for more than 24 h in ruminal fluid (Kung et al., 1997).

Subacute ruminal acidosis is characterized by daily episodes of low ruminal pH (<5.8), lasting several minutes to several hours (Dohme et al., 2008). The diet used in the present study reduced ruminal pH below 5.8 for several hours, inducing SARA, probably due to rapid accumulation of VFA (Erfle et al., 1982). Low ruminal pH for prolonged periods can negatively affect DMI and fiber degradation, resulting in reduced productive performance and subsequently large financial losses (Chaucheyras-Durand et al., 2008). In view of the consequences of SARA, elevated ruminal pH with yeast supplementation, in the present study, may be of considerable importance in terms of improving animal performance. These findings are in accordance with observations reported previously (Williams et al., 1991; Nocek et al., 2002; Bach et al., 2007). However, effects of ADY on ruminal pH have been inconsistent amongst studies probably due to differences in the basal diets used and the severity of SARA incurred (Beauchemin et al., 2003) or to the strain of yeast used (Chung et al., 2011).

Divergent modes of action have been proposed for ADY and KDY to stabilize ruminal pH. Active dried yeast has been suggested to act mainly as a probiotic. The stabilizing effect on ruminal pH has been ascribed to reduced lactate concentration, due to the nutritional competition between S. cerevisiae and lactic acid producing bacteria (S. bovis; Chaucheyras et al., 1996) and the stimulation of lactic acid utilizing bacteria such as Selenomonas ruminantium (Nisbet and Martin, 1991; Callaway and Martin, 1997) and M. elsdenii (Callaway and Martin, 1997). However, KDY is thought to function as a prebiotic (Oeztuerk et al., 2005; Oeztuerk, 2009) as it has been shown to have stimulatory effects on M. elsdenii (Chaucheyras et al., 1995, 1996) in vitro by providing various growth factors, pro-vitamins, and micronutrients although these effects have not been examined in vivo.

However, contrary to the proposed mode of action for ADY and results observed in previous studies (Williams et al., 1991), elevated ruminal pH with ADY was not associated with a reduction in ruminal lactate concentration. With the type of diet used, the lactate concentrations were minimal and unlikely to account for the acidosis-prevention properties exhibited with yeast supplementation in the present study. Another possibility is that because ADY can utilize starch and soluble sugars, it may help lower the rate of acid production in the rumen, further lowering the incidence of SARA (Chaucheyras et al., 1996). However, this explanation appears implausible based on lack of treatment effects on total and individual VFA concentrations and it does not explain the stabilizing effects of KDY on ruminal pH. Hence, based on our results, the positive effect of both ADY and KDY on ruminal pH go beyond lactic acid and starch utilization. Bach et al. (2007) observed a significant increase in the meal frequency leading to stabilization of ruminal pH with ADY. Because feeding behavior was not measured in our study, it is not possible to confirm whether a similar mechanism exists for both ADY and KDY and therefore effects of yeast on feeding behavior need to be investigated further.

The effects observed on NH3–N with both ADY and KDY are consistent with previous in vitro studies using either ADY (Miller-Webster et al., 2002) or both ADY and KDY (Oeztuerk, 2009). However, most of the previous animal studies have shown either no effects (Newbold et al., 1996; Yoon and Stern, 1996; Thrune et al., 2009) or reduced ruminal NH3–N concentration (Erasmus et al., 1992; Lascano and Heinrichs, 2007) in response to yeast supplementation. The effects on NH3–N in various in vitro studies (Miller-Webster et al., 2002; Oeztuerk, 2009) were attributed to the microbial degradation of yeast cells because of their high protein content. However, this explanation might not be pertinent to the present study because the level of yeast supplementation was lower (0.35 mg/g of DMI) as compared to previous in vitro studies (Miller-Webster et al., 2002; Oeztuerk, 2009) and microbial degradation of yeast cells supplemented at lower levels would not increase NH3–N concentration.

Another probable explanation for increased ruminal NH3–N concentration could be the stimulation of proteolytic activity of ruminal bacteria as shown earlier with supplementation of yeast culture in lactating dairy cows (Yoon and Stern, 1996). Streptococcus bovis, predominantly a starch degrading bacteria, was shown to have high proteolytic activity (Russell et al., 1981) resulting in deamination of amino acids and production of NH3 in the rumen. However, lack of treatment differences on relative abundance of S. bovis indicate that changes observed in NH3–N concentration cannot be attributed to changes in population size of S. bovis. Therefore, the results have to be taken in context of the fact that the species monitored in this study represent a very small fraction of all known rumen microbes and it is possible that we might have failed to detect changes in various other microbial species that could explain the effects observed in this study.

Megasphaera elsdenii is considered a major lactate utilizing bacterial species with greater abundance observed in the rumen of cattle fed high grain diets (Chaucheyras-Durand et al., 2008). The abundance of M. elsdenii was low in the present study and probably related to greater proportion of forage than in earlier studies (Stevenson and Weimer, 2007; Petri et al., 2012). Previously, yeast supplementation increased relative abundance of M. elsdenii thereby reversing the effect of mild grain induced SARA in lactating dairy cows (Pinloche et al., 2013). However, the lack of treatment effect on abundance of M. elsdenii in the present study might be attributed to minimal lactate concentrations.

The fiber degrading communities were represented by the relative abundance of F. succinogenes and R. flavefaciens in the present study. The relative abundance of F. succinogenes is in agreement with previous studies (Stevenson and Weimer, 2007; Weimer et al., 2008). Fibrobacter succinogenes is considered the major cellulolytic bacterium in the rumen (Halliwell and Bryant, 1963; Koike and Kobayashi, 2009); however, based on greater abundance observed in both liquid and solid fraction of digesta, R. flavefaciens might be the main fibrolytic bacterium under the dietary conditions of the present study. Supporting this assumption is the fact that R. flavefaciens was about 4-fold greater in the solid than liquid fraction of the digesta as shown earlier (Petri et al., 2012). It has been observed that R. flavefaciens can outcompete F. succinogenes by rapid binding to cellulose (Roger et al., 1990) and has greater affinity for cellodextrins released by cellulose hydrolysis (Shi and Weimer, 1996). However, whether a similar mechanism mediated the greater relative abundance of R. flavefaciens in our study is not clear and needs further investigation.

Ruminal pH plays an important role in regulating the population and activity of fiber degrading communities (Russell and Wilson, 1996; Chaucheyras-Durand et al., 2008). Elevated ruminal pH optimizes the ruminal environment and promotes fiber-degrading microbiota resulting in increased rate of cellulolysis and subsequently forage digestion (Williams et al., 1991). Although ruminal conditions were less acidic with yeast supplementation, the moderate severity of acidosis obtained in the present study might not have been detrimental to the cellulolytic population and could explain the lack of significant effects with ADY on the cellulolytic bacteria. However, the reason for increased relative abundance of R. flavefaciens with KDY was unclear. Nevertheless, lack of treatment effects on fiber digestion suggests that increased relative abundance of R. flavefaciens might not be related with corresponding changes in ruminal fermentation unless the treatment induces a 10- to 100-fold change in the microbial population (Yoon and Stern, 1996). Lack of significant treatment effects might also be attributed to the measurement of total tract digestibility of nutrients. Greater abundance of fibrolytic bacteria might enhance fiber degradation in rumen; however, ruminal effects might be offset by greater hindgut fermentation in Control animals resulting in no treatment differences (Yoon and Stern, 1996).


Conclusion

This probiotic strain of S. cerevisiae, evaluated as ADY and KDY, elevated ruminal pH and reduced acidotic conditions in the rumen. However, because no treatment effects were observed on ruminal lactate, total VFA concentration, or VFA profile, the mechanism by which yeast affects ruminal pH is not clear and needs further evaluation. Also, the severity of acidosis was only moderate in the present study, and therefore it remains unclear whether viability of yeast is required to elicit similar beneficial effects on ruminal pH with greater concentrate diets.

 

References

Footnotes


Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.