View Full Table | Close Full ViewTable 1.

Ingredient composition of the total mixed ration and melengestrol acetate (MGA) supplement

 
Item % of DM
Ingredient
    Barley silage1 40.0
    Chopped grass hay2 10.0
    Barley grain, dry rolled3 42.5
    Supplement4 5.0
        Canola meal 4.100
        Barley, ground 3.517
        Canola oil 0.057
        Limestone 0.300
        Salt 0.050
        Urea 0.400
        Molasses 1.500
        Vitamin E (500,000 IU/kg) 0.006
        Feedlot premix5 0.050
    MGA6 2.5
        MGA-100 premix 0.013
        Barley, ground 2.428
        Molasses, dried 0.057
        Flavoring, cattle 0.002
Chemical composition
    DM, % 50.7 ± 2.23
    OM, % of DM 91.8 ± 0.79
    CP, % of DM 12.4 ± 0.75
    NDF, % of DM 39.9 ± 4.23
    ADF, % of DM 19.5 ± 4.19
    Starch, % of DM 33.8 ± 4.48
1Composition (mean ± SD; % DM basis): 33.8 ± 2.14 DM, 88.9 ± 6.08 OM, 11.4 ± 1.36 CP, 55.2 ± 7.91 NDF, 30.3 ± 9.04 ADF, and 16.3 ± 1.73 starch.
2Composition (mean ± SD; % DM basis): 91.2 ± 0.62 DM, 93.4 ± 0.67 OM 6.47 ± 0.45 CP, 67.2 ± 4.79 NDF, 40.4 ± 0.86 ADF, and 3.66 ± 0.49 starch.
3Composition (mean ± SD; % DM basis): 91.9 ± 0.95 DM, 97.8 ± 0.16 OM 13.2 ± 1.26 CP, 20.2 ± 0.64 NDF, 5.97 ± 0.89 ADF, and 49.2 ± 6.83 starch.
4Composition (mean ± SD; % DM basis): 95.0 ± 0.69 DM, 63.3 ± 4.05 OM 18.2 ± 0.65 CP, 21.5 ± 4.19 NDF, 6.21 ± 0.52 ADF, and 42.3 ± 2.06 starch.
5Feedlot premix provided to diet DM an additional 14 g/kg Ca, 103 mg/kg Zn, 26 mg/kg Cu, 47 mg/kg Mn, 1 mg/kg I, 0.50 mg/kg Se, 0.33 mg/kg Co, 17,187 IU/kg vitamin A, 859 IU/kg vitamin D3, and 24 IU/kg vitamin E.
6Composition (mean ± SD; % DM basis): 91.6 ± 1.68 DM, 96.7 ± 0.48 OM 12.5 ± 1.48 CP, 15.8 ± 3.17 NDF, 6.57 ± 1.60 ADF, and 56.0 ± 3.28 starch.



View Full Table | Close Full ViewTable 2.

Features of primers used for quantitative PCR analysis

 
Gene Primers (5′-3′)1 Size2 Reference
Total bacteria BAC338F: ACTCCTACGGGAGGCAG
BAC805R: GACTACCAGGGTATCTAATCC
200 Yu et al. (2005)
Streptococcus bovis F: TTCCTAGAGATAGGAAGTTTCTTCGG
R: ATGATGGCAACTAACAATAGGGGT
127 Stevenson and Weimer (2007)
Megasphaera elsdenii F: AGATGGGGACAACAGCTGGA
R: CGAAAGCTCCGAAGAGCCT
79 Stevenson and Weimer (2007)
Fibrobacter succinogenes F: GCGGGTAGCAAACAGGATTAGA
R: CCCCCGGACACCCAGTAT
70 Stevenson and Weimer (2007)
Ruminococcus flavefaciens F: TGGCGGACGGGTGAGTAA
R: TTACCATCCGTTTCCAGAAGCT
71 Stevenson and Weimer (2007)
1Primer direction (F = forward; R = reverse).
2Amplicon size in bp.



View Full Table | Close Full ViewTable 3.

Dry matter intake and BW of beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Variable Treatment
SEM P-value
Control1 ADY KDY
DMI, kg/d 11.3 11.3 11.7 0.73 0.86
DMI, % of BW 1.51 1.50 1.57 0.10 0.86
BW, kg 744 752 748 34.1 0.89
Initial BW, kg 735 741 738 35.9 0.95
Final BW, kg 754 764 758 32.8 0.82
Change of BW, kg 18.5 23.5 20.3 6.51 0.86
1Control = no yeast.



View Full Table | Close Full ViewTable 4.

Ruminal pH profile of beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Variable Treatment
SEM P-value
Control1 ADY KDY
Mean pH 6.06b 6.28a 6.26a 0.121 0.02
Minimum pH 5.48b 5.65a 5.67a 0.103 <0.01
Maximum pH 6.74 6.84 6.77 0.054 0.12
Range in pH2 1.27a 1.19ab 1.10b 0.062 0.02
Ruminal pH < 5.8
    Duration of day,3 h/d 7.03a 3.55b 3.66b 2.161 <0.01
    AUC,4 pH × min/d 110 71 47 52.9 0.19
    Bout frequency, no./d 9.2 a 4.9b 6.3b 1.58 0.05
    Long bout (>3 h) frequency, no./d 0.69a 0.25b 0.33b 0.298 0.01
Ruminal pH < 5.6
    Duration of day, h/d 4.41a 2.47b 1.91b 1.399 <0.01
    AUC, pH × min/d 42 37 14 13.5 0.09
    Bout frequency, no./d 7.3 4.2 4.4 1.72 0.07
    Long bout (>3 h) frequency, no./d 0.44 0.13 0.11 0.224 0.12
a,bValues within a row with different letters differ (P ≤ 0.05).
1Control = no yeast.
2Range = maximum ruminal pH – minimum ruminal pH.
3Subacute ruminal acidosis measured as duration below the pH threshold (5.6 or 5.8).
4AUC =area under curve.



View Full Table | Close Full ViewTable 5.

Ruminal fermentation characteristics of beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Variable Treatment
SEM P-value
Control1 ADY KDY Treatment Hour Treatment × hour
Total VFA, mM 104 102 106 5.44 0.89 <0.01 0.25
Individual VFA, mol/100 mol
    Acetate (A) 63.5 63.4 63.1 1.02 0.96 <0.01 0.06
    Propionate (P) 18.7 18.8 18.3 0.96 0.86 <0.01 0.61
    Isobutyrate 1.0 1.0 1.0 0.03 0.85 <0.01 0.96
    Butyrate (B) 12.0 12.2 12.8 0.48 0.47 0.22 0.68
    Valerate 1.78 1.73 1.80 0.07 0.76 <0.01 0.59
    Isovalerate 1.97 1.88 1.92 0.09 0.77 0.04 0.46
    Caproate 1.03 0.99 1.13 0.09 0.39 <0.01 0.85
Lactate, mM
Mean 0.17 0.06 0.08 0.07 0.46 0.07 0.68
Maximum 0.32 0.10 0.14 0.14 0.44 0.07 0.68
A:P ratio 3.55 3.47 3.55 0.23 0.95 <0.01 0.54
(A + B):P ratio 4.21 4.14 4.27 0.28 0.90 <0.01 0.58
NH3–N, mM 6.66 8.39 7.55 0.81 0.08 <0.01 0.81
Total protozoa, ×105 cells/mL 7.4 6.9 7.1 0.87 0.92 <0.01 0.83
1Control = no yeast.



View Full Table | Close Full ViewTable 6.

Relative population size (percentage of target species relative to total bacterial content) of rumen bacteria in beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Ruminal bacteria Liquid
Solid
SEM P-value
Control1 ADY KDY Control ADY KDY Treatment Phase Interaction
Megasphaera elsdenii (×10–2) 0.5 0.4 0.5 1.3 0.7 0.7 0.32 0.63 <0.01 0.21
Streptococcus bovis 0.02 0.02 0.02 0.05 0.08 0.08 0.012 0.12 <0.01 0.30
Fibrobacter succinogenes 0.87 0.83 0.91 0.89 0.81 0.76 0.114 0.91 0.37 0.43
Ruminococcus flavefaciens 2.1c 1.9c 2.0c 7.7b 7.3b 9.7a 0.47 0.05 <0.01 0.01
a,bValues within a row with different letters differ (P ≤ 0.05).
1Control = no yeast.



View Full Table | Close Full ViewTable 7.

Apparent total tract digestibility of nutrients for beef heifers fed a diet supplemented with a strain of Saccharomyces cerevisiae as active dried yeast (ADY) or killed dried yeast (KDY)

 
Nutrient Treatment
SEM P-value
Control1 ADY KDY
DM, % 58.9 60.9 63.5 1.43 0.16
OM, % 61.0 62.9 65.6 1.55 0.20
CP, % 48.9 48.8 52.0 2.37 0.36
NDF, % 37.2 39.8 42.1 1.96 0.38
ADF, % 43.5 47.1 48.2 1.49 0.17
Starch, % 89.5 91.1 93.8 1.08 0.07
1Control = no yeast.