Search
Author
Title
Vol.
Issue
Year
1st Page

Journal of Animal Science - Animal Physiology

Effect of resveratrol and lipoic acid on sirtuin-regulated expression of metabolic genes in bovine liver and muscle slice cultures12

 

This article in JAS

  1. Vol. 93 No. 8, p. 3820-3831
     
    Received: Feb 24, 2015
    Accepted: May 10, 2015
    Published: July 10, 2015


    3 Corresponding author(s): ofemora66@unam.mx
    ofemora2001@yahoo.com.mx
 View
 Download
 Share

doi:10.2527/jas.2015-8819
  1. Y. Ghinis-Hozumi*,
  2. L. González-Dávalos,
  3. A. Antaramian,
  4. F. Villarroya§,
  5. E. Piña#,
  6. A. Shimada,
  7. A. Varela-Echavarría and
  8. O. Mora 3
  1. * Programa de Posgrado en Ciencias de la Producción y de la Salud Animal (PCiPSA), Universidad Nacional Autónoma de México (UNAM), Mexico City 04510, Mexico
     Laboratorio de Rumiología y Metabolismo Nutricional (RuMeN), Secretaría de Posgrado, Facultad de Estudios Superiores-Cuautitlán (FESC), UNAM, Blvd. B. Quintana 514-D, Col. Arboledas, Querétaro, Qro. 76140, Mexico
     Instituto de Neurobiología (INB), UNAM, Blvd. Juriquilla 3001, Querétaro, Qro. 76230, Mexico
    § Departamento de Bioquímica y Biología Molecular e Instituto de Biomedicina (IBUB), Universitat de Barcelona y CIBER Fisiopatología de la Obesidad y Nutrición, Av. Diagonal 645, Barcelona 08028, Spain
    # Departamento de Bioquímica, Facultad de Medicina, UNAM, Mexico City 04510, Mexico

Abstract

Sirtuins (Sirt) are NAD-dependent deacetylases that are activated by the antioxidants resveratrol (RSV) and lipoic acid (LA). The objective of this study was to determine in bovine liver and muscle slice cultures the effect of RSV and LA treatment on the expresssion of Sirt1, Sirt3, peroxisome proliferator-activated receptor γ coactivator 1α (PPARGC1A), and the forkhead box O transcription factors FoxO1 and FoxO3 as well as other factors involved in glucose and lipid metabolism and related to Sirt activity. Tissue slices from crossbred bulls were treated during 60 min with 40 or 80 μM RSV and 30, 100, 300, or 1,000 μM LA under restricted conditions (Krebs-Ringer buffer without nutrients) and fed conditions (2.5 mM propionate in combination with 1 nM glucagon) for liver slices or with 0.01 μM epinephrine for muscle slices. Quantitative real-time PCR was used to analyze the expression of the mRNA for the genes studied and western blot analysis for the expression of the protein for Sirt1. Our results show that the expression of the mRNA for Sirt1 was enhanced by RSV in liver under restriction (P ≤ 0.0112) and by LA in muscle, more under restriction (P ≤ 0.0121) than after epinephrine administration (P < 0.0001). Sirt3 is affected in a dose-dependent manner by both compounds in both tissues and under both metabolic conditions (P ≤ 0.0452). The expression of the protein for Sirt1 was increased by LA in both tissues under restricted conditions (P = 0.0026 and P = 0.0201, respectively) but in liver also in fed conditions (P = 0.0016). Genes involved in the antioxidant response were upregulated in both tissues. These results indicate that bovine Sirt respond differently to RSV and LA stimulation than monogastric Sirt do and that gluconeogenesis in ruminants is not related to Sirt to the same degree as in monogastric species. However, these results provide information about the possible role of Sirt in ruminant metabolism.



INTRODUCTION

Sirtuins (Sirt) are NAD-dependent protein deacetylases that can be activated by resveratrol (RSV) and α-lipoic acid (LA; Howitz et al., 2003; Chen et al., 2012; Valdecantos et al., 2012).

Sirtuins have been widely studied in lower organisms, rodents, and humans because of their role in energy metabolism (Guarente, 2000). In liver, Sirt1 regulates gluconeogenesis in response to fasting through the deacetylation and activation of the peroxisome proliferator-activated receptor γ coactivator 1α (PPARGC1A) and the forkhead box O1 transcription factor (FoxO1; Imai and Guarente, 2010), promoting the expression of the gluconeogenic genes phosphoenolpyruvate carboxykinase (PCK) and glucose-6-phosphatase (G6PC; Erion et al., 2009). In muscle, Sirt1 deacetylates PPARGC1A to switch from glucose to free fatty acid oxidation under nutrient deprivation (Nasrin et al., 2010). The AMP-activated protein kinase (PRKAA) activates the Sirt, PPARGC1A, and the FoxO transcription factors, regulating lipid metabolism and mitochondrial biogenesis (Nasrin et al., 2010; Chang and Guarente, 2014). Mitochondrial Sirt3 regulates mitochondrial biogenesis and function and the response to oxidative stress by deacetylating PPARGC1A, FoxO1, FoxO3, PRKAA (Kong et al., 2010), and isocitrate dehydrogenase (IDH2; Smolková and Ježek, 2012).

Gluconeogenesis is the major pathway through which glucose needs are satisfied in ruminants, providing approximately 90% of the requirements in adult animals (Nafikov and Beitz, 2007). Because there is no information available on the role of Sirt in the regulation of energy metabolism in this species, especially gluconeogenesis, the main objective of the present work was to determine, in vitro, the role of Sirt1 and Sirt3 in ruminant liver gluconeogenesis and muscle glycogenolysis by assessing their gene expression and that of some of their target transcription factors in liver and muscle slices of bovines challenged with RSV or LA to obtain an initial insight into the subject.


MATERIALS AND METHODS

Animals and Slice Cultures

The experimental protocol was approved by the Universidad Nacional Autónoma de México Animal Care Advisory Committee and all procedures were performed in accordance with the Mexican federal laws for animal care and protection.

Liver and semitendinosus/semimembranosus muscle samples were collected from 6 crossbred bulls immediately after slaughter at the local abattoir in Santiago de Querétaro, Querétaro, Mexico. Time elapsed from collection to lab work was less than 60 min and the collection and slice obtention methods were previously described by Arias et al. (2009). Briefly, tissues were placed in ice-cold sterile Krebs-Ringer buffer (KRB; 120 mM NaCl, 5.7 mM KCl, 1.2 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgSO4, and 12 mM NaHCO3, pH 7.4) supplemented with 100 IU/mL penicillin and 100 μg/mL streptomycin (Invitrogen Life Technologies, Carlsbad, CA) and transported to the laboratory, where they were cleaned and manually sliced under a laminar flow hood in clean and cold sterile KRB supplemented with antibiotics. Liver and muscle slices (>50 mg fresh weight) were incubated in 0.5 mL of the treatment media (see below) for 60 min at 37°C under a humidified atmosphere with 5% CO2. Four wells were used as replicates for each treatment. The incubation time was chosen after preliminary assays in which liver slices were incubated for 0, 15, 30, 60, 120, and 180 min with propionate (2.5 and 5 mM; Aiello and Armentano, 1987) plus glucagon (0, 1, 10, and 100 nM; Donkin and Armentano, 1993) and glucose release to the medium was measured (data not shown). After incubation, slices were collected, weighed, frozen in liquid nitrogen, and stored at –70°C. Culture media were collected and kept at –20°C. Slices for 2 experimental zero-time controls were placed in the wells with culture medium and immediately collected as described.

Treatments

Basal medium used to mimic restricted conditions was KRB supplemented with antibiotics. Basal medium was supplemented with propionate (2.5 mM) plus glucagon (1 nM) for liver slices and epinephrine (0.01 μM) for muscle slices to mimic the ruminant gluconeogenic state or glycogen metabolism, respectively. Additionally, RSV (40 or 80 μM) and LA (30, 100, 300, or 1,000 μM) were tested to evaluate their effects as Sirt activators. The RSV doses used were previously reported in porcine adipocytes (Shan et al., 2009), whereas those for LA were tested by Chen et al. (2012) using both the Fluor de Lys kit and C2C12 myoblasts. Propionate, glucagon, and epinephrine were from Sigma-Aldrich (St. Louis, MO). Lipoic acid was purchased from Future Foods (Tlalnepantla, Edo. de México, Mexico).

Total RNA Extraction and cDNA Synthesis

For total RNA, the frozen slices were homogenized on ice with a polytron in cold TRIzol reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions except for an overnight incubation at –20°C in 75% ethanol and an additional 75% ethanol wash before drying the pellet; all reagents were used at 4°C. These modifications enhanced the purity of the final products. The RNA samples were quantified at 260 nm in the NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE), and they were checked for purity (260:280 ratio) and integrity (1% agarose gel electrophoresis).

One microgram total RNA in a volume of 40 μL was used to synthesize cDNA in a Bio-Rad T100 thermal cycler (Bio-Rad Laboratories Inc., Hercules, CA). The RNA samples were first incubated with 0.75 units deoxyribonuclease (Roche Applied Science, Mannheim, Germany) for 15 min at room temperature and then for another 5 min at 70°C to reduce genomic DNA contamination. Complementary DNA were then prepared by adding 0.25 μM oligo (dT)12–18 primer (Sigma-Genosys, St. Louis, MO), 0.25 mM deoxyribonucleotide triphosphate mixture (Invitrogen Life Technologies), 1x Moloney murine leukemia virus (M-MLV) reaction buffer, 1 unit Recombinant RNasin Ribonuclease Inhibitor (Promega, Madison, WI), and 5 units M-MLV Reverse Transcriptase (Promega) followed by incubations at 42°C for 60 min and at 70°C for 15 min.

Expression Analysis by Real-Time PCR

The expression of mRNA for Sirt1, Sirt3, PPARGC1A, FoxO1, FoxO3, IDH2, PRKAA α1 catalytic subunit (PRKAA1), PCK1, G6PC, uncoupling protein 3 (UCP3), and fibroblast growth factor 21 (FGF21) was quantified using real-time PCR (see Supplemental Table S1 for a description on the function of these genes; see the online version of the article at http://journalofanimalscience.org). The quantification was made relative to the geometric mean expression of the most stable pair of housekeeping genes (Vandesompele et al., 2002) chosen from a set of 6 (peptidylprolyl isomerase A/cyclophilin A [PPIA], 18S ribosomal RNA [RNA18S1], β-actin [ACTB], tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta [YWHAZ], eukaryotic translation elongation factor 1α1 [EEF1A1], and ribosomal protein L13a [RPL13A]).

Making use of the Oligo Primer Analysis Software (Molecular Biology Insights, Inc., Cascade, CO), primer pairs for all genes analyzed were designed (Table 1). Expression profiles were determined with a StepOne Real-Time PCR system (Applied Biosystems, Carlsbad, CA) and the LightCycler FastStart DNA Master Sybr Green I (Roche Applied Science). Reactions were prepared using 1 μL FastStart DNA Master Sybr Green I, 3.5 mM MgCl2, 0.25 μM of each primer—except for Sirt3, whose forward primer was used at 0.19 μM—5 μL of a 1:10 dilution of the cDNA, and PCR-grade H2O added to a final volume of 10 μL.


View Full Table | Close Full ViewTable 1.

Real-time PCR primers for bovine target and housekeeping genes mRNA

 
Gene Gene number Primer sequence (5′ → 3′) Position Fragment size Tissue analyzed
Sirt1 XM_864818.2 Forward: ATACACTGGAGCAGGTT 1,031–1,047 164 bp Liver and Muscle
Reverse: TTCATCAGCTGGGCATCTAG 1,175–1,194
Sirt3 XM_873980.3 Forward: GCTAGGTTCCTGCTGCATCT 746–765 264 bp Liver and Muscle
Reverse: GATGAGGTCCTGGATGTCGT 990–1,009
PPARGC1A NM_177945.3 Forward: GTGAAGACCAGCCTCTTTGC 155–174 109 bp Liver and Muscle
Reverse: TCACTGCACCACTTGAGTCC 244–263
FoxO1 XM_583090.6 Forward: TCTTACGCCGACCTCATCACC 940–960 122 bp Liver and Muscle
Reverse: TTGCTGTCGCCCTTATCCTTG 1,041–1,061
FoxO3 NM_001206083.1 Forward: CTACGCCGATCTGATCACTCG 480–500 119 bp Liver and Muscle
Reverse: TGCTGTCGCCCTTATCCTTG 579–598
IDH2 NM_175790.2 Forward: CCACTATGCCGACAAGAGGA 177–196 170 bp Liver and Muscle
Reverse: CATTGGTCTGGTCACGGTTC 327–346
PRKAA1 BC153842.1 Forward: CCATGAAGAGAGCCACAATC 912–931 253 bp Liver and Muscle
Reverse: GCCTCGTTCATTATCCTCCT 1,145–1,164
PCK1 NM_174737.2 Forward: AACGCCATCAAGACCATCCA 1,174–1,193 141 bp Liver
Reverse: GTCCCACTCCTTGCCCTTC 1,296–1,314
G6PC NM_001076124.2 Forward: ATGTTGTGGTTGGGATTCTG 526–545 189 bp Liver
Reverse: CAGGAAGCAGGTGATGAGAA 695–714
UCP3 NM_174210.1 Forward: CCGTCAAGCAGTTCTACACC 499–518 210 bp Muscle
Reverse: CTCTGGCGATGGTCCTGT 691–708
FGF21 XM_002695200.2 Forward: CGGATCGCTGCACTTTGAC 624–642 76 bp Muscle
Reverse: CTGGTAGACGTTGTATCCATCTTCA 675–699
PPIA NM_017101.1 Forward: AGCACTGGGGAGAAAGGATT 160–179 248 bp Liver and Muscle
Reverse: AGCCACTCAGTCTTGGCAGT 388–407
YWHAZ NM_174814.2 Forward: CGGACACAGAACATCCAGT 34–52 242 bp Liver and Muscle
Reverse: TTTTCTCAGCACCTTCCGTCT 256–276
EEF1A1 NM_001402.5 Forward: TGCCCTTCTGTCTTACACC 471–489 166 bp Liver and Muscle
Reverse: CACAAATGCTACCGTGTCG 618–636
RPL13A NM_012423.3 Forward: CTGCCCCACAAGACCAAGC 347–366 179 bp Liver and Muscle
Reverse: TGGTACTTCCAGCCAACCTCA 505–525
RNA18S1 NR_036642.1| Forward: GGAGCGATTTGTCTGGGTTA 1,351–1,370 196 bp Liver and Muscle
Reverse: GTAGGGTAGGCACACGCTGA 1,527–1,546
ACTB NM_031144.3 Forward: CCATCATGAAGTGTGACGTTG 920–940 175 bp Liver and Muscle
Reverse: ACAGAGTACTTGCGCTCAGGA 1,074–1,094

The real-time PCR program for the 6 housekeeping genes, PPARGC1A, FoxO1, FoxO3, PCK1, and UCP3 was started with a denaturation step (10 min at 95°C) followed by forty-five 3-step amplification cycles consisting of denaturation (10 s at 95°C), annealing (10 s at 60°C), and elongation (10 s at 72°C) and terminated with a melting curve analysis begun with denaturation at 95°C followed by a 1-min annealing at 50°C and then gradual heating up to 95°C at a rate of 0.5°C per second with continuous measurement of the fluorescence signal.

The number of amplification cycles for G6PC, IDH2, and PRKAA1 was 40 and for Sirt3 and FGF21 was 50. Annealing for Sirt1 was at 58°C, for Sirt3 was at 64°C, and for IDH2 was at 65°C. Elongation at 72°C for G6PC, FGF21, IDH2, and PRKAA1 was for 12 s, and for Sirt3 it was for 15 s. The starting temperature for the melting curve annealing was 55°C for Sirt3; 60°C for G6PC, FGF21, and PRKAA1; and 65°C for IDH2.

Identities of the PCR products obtained were verified by sequencing with a 310 ABI Prism Sequencer with version 3 Big Dye (Applied Biosystems). The expression stability of the housekeeping genes was analyzed using Normfinder (Andersen et al., 2004), GeNorm (Vandesompele et al., 2002), and BestKeeper (Pfaffl et al., 2004). For all target genes, expression was quantified using the 2–ΔΔCt method as described (Livak and Schmittgen, 2001; Schmittgen and Livak, 2008).

Western Blot Analysis

Frozen tissue slices and rat liver (for the positive control) were homogenized in cold extraction buffer (100 mM Tris-HCl, pH 8.5, 250 mM NaCl, 1 mM EDTA, 1% Igepal CA-630 [Sigma-Aldrich], 0.5 mM dithiothreitol, 10 μg/mL aprotinin, 1 μg/mL leupeptin, 1 μg/mL pepstatin, 2.5 mM benzamidine, and 0.5 mM phenylmethylsulfonyl fluoride) with 800 μL buffer per 100 mg tissue. After homogenization, samples were incubated at 4°C under orbital agitation for 60 min and centrifuged at 4°C for 10 min at 15,294 × g. Protein concentrations were obtained using 40 μL of the Bio-Rad Protein Assay Dye Reagent concentrate (Bio-Rad Laboratories Inc.), and the protein extracts were diluted 10- and 2.5-fold for liver and muscle, respectively, in a final reaction volume of 200 μL (micro-Bradford assay), measured at 595 nm in a Thermo Scientific VarioSkan Flash Multimode Reader (Thermo Fisher Scientific Inc.), and quantified as described by Olson and Markwell (2007). Fifty micrograms of protein were separated by 8% SDS-PAGE and transferred to 0.2-μm nitrocellulose membranes (Bio-Rad Laboratories Inc.) using wet tank electroblotting. Membranes were blocked with 5% skim milk (Bio-Rad Laboratories Inc.) in Tris-buffered saline (TBS)-Tween 0.1% for 1 h at room temperature. The membranes were then incubated with 1:100 rabbit polyclonal anti-Sirt1 antibody (sc-15404; Santa Cruz Biotechnology Inc., Santa Cruz, CA) and 1:2,000 mouse monoclonal anti-ACTB antibody. Secondary antibodies were horseradish peroxidase-conjugated anti-rabbit (1:1,500, sc-2004; Santa Cruz Biotechnology Inc.) and anti-mouse (1:1,000, 115-036-003; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Antibodies were prepared in TBS-Tween 0.1% with 1% skim milk. Detection was with the HRP Conjugate Substrate Kit (Bio-Rad Laboratories Inc.) following the manufacturer’s instructions. Membranes were scanned, and signals were quantified with the ImageJ software (National Institutes of Health, Bethesda, MD).

Statistical Analysis

Data were analyzed with a completely randomized model to ascertain the gene expression and a completely randomized model with the animal effect nested within the treatment effect was used to determine the effect of the treatments. Additionally, the protein expression data were blocked by the animal in a completely randomized block design and analyzed for outliers using Iglewicz and Hoaglin’s robust test for multiple outliers (online calculator of Contchart Software, Sechelt, BC, Canada). A 1-way ANOVA was obtained for each analysis using the SAS statistical software GLM procedure (SAS Inst. Inc., Cary, NC). The significance threshold was set at P ≤ 0.05. Least squares means ± SEM were used to analyze the differences within each data set.


RESULTS

Effect of Resveratrol and Lipoic Acid Treatments on mRNA Expression sof the Analyzed Genes in Bovine Liver Slices

Under the restricted condition (Fig. 1, bars 1–7), both RSV doses (bars 2 and 3) upregulated the expression of Sirt1 (P < 0.0001 and P = 0.0112, respectively), Sirt3 (P < 0.0001 for both), FoxO1 (P < 0.0001 and P = 0.0006, respectively), FoxO3 (P < 0.0001 for both), and IDH2 (P < 0.0001 for both) and they downregulated PCK1 (P < 0.0001 for both). The PRKAA1 mRNA level was increased (P = 0.0001) only by the 40 μM RSV treatment (bar 2), and 80 μM RSV (bar 3) had the opposite effect on PPARGC1A (P = 0.0003) and G6PC (P < 0.0001) expression.

Figure 1.
Figure 1.

Effect of resveratrol (RSV) and lipoic acid (LA) treatments on mRNA expression of the genes analyzed in bovine liver slices. Relative expression levels (y-axis) of the mRNA for the genes studied were determined by quantitative real-time PCR in bovine liver slices under restricted (Krebs-Ringer buffer [KRB]; bars 1–7) or under fed conditions (propionate and glucagon in KRB; bars 8–14). All gene expression levels were normalized to the geometric mean of the housekeeping genes eukaryotic translation elongation factor 1α1 (EEF1A1) and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta (YWHAZ) by the 2–ΔΔCt method. Data from 6 animals are presented as the least squares means ± SEM. a–fDifferent lowercase letters indicate a significant difference between treatments under the same experimental condition (restricted or fed; P < 0.05). Treatments are ordered as follows: Control (bars 1 and 8), 40 μM RSV (bars 2 and 9), 80 μM RSV (bars 3 and 10), 30 μM LA (bars 4 and 11), 100 μM LA (bars 5 and 12), 300 μM LA (bars 6 and 13), and 1,000 μM LA (bars 7 and 14).

 

When liver slices were subjected to the feeding condition, that is, addition of propionate and glucagon to the culture media to promote gluconeogenesis (Fig. 1, bars 8–14), the effects of both RSV treatments (bars 9 and 10) were hindered as compared with the restricted condition, resulting in a milder increase of Sirt3 (P < 0.0001 for both), FoxO1 (P < 0.0001 and P = 0.0215, respectively), and FoxO3 (P < 0.0001 for both) expression. In the case of Sirt1, mRNA expression was positively regulated (P = 0.0403) only by the 40 μM RSV treatment (bar 9). Both doses of RSV had a negative effect on the expression of PPARGC1A (P = 0.0001 and P < 0.0001 , respectively) and PCK1 (P < 0.0001 for both), and these treatments had no effect on IDH2 (P = 0.4403 and P = 0.4340, respectively), PRKAA1 (P = 0.0620 and P = 0.0618, respectively), and G6PC (P = 0.5393 and P = 0.4235, respectively) expression.

In contrast, in experiments performed in liver slices exposed to the restricted condition together with LA (Fig. 1, bars 4–7), the doses tested had no effect on Sirt1 expression (P = 0.6989, P = 0.8596, P = 0.4556, and P = 0.8466 , respectively) and they downregulated the FoxO3 (P < 0.0001 for all), IDH2 (P = 0.0092 for 30 μM and P < 0.0001 for the rest), and PCK1 (P < 0.0001 for all) expression. The effect on the other genes studied was dose dependent: for instance, 30 μM LA (bar 4) promoted the expression of Sirt3 (P = 0.0086), FoxO1 (P < 0.0001), PRKAA1 (P = 0.0050), and G6PC (P < 0.0001); 100 μM LA (bar 5) positively regulated G6PC (P < 0.0001) expression; 300 μM LA (bar 6) increased Sirt3 (P = 0.0145), PPARGC1A (P < 0.0001), FoxO1 (P < 0.0001), and G6PC (P = 0.0302); and 1,000 μM LA (bar 7) enhanced PPARGC1A (P < 0.0001) and FoxO1 (P < 0.0001) but reduced G6PC (P < 0.0001) expression.

When propionate and glucagon were added in combination with LA (Fig. 1, bars 11–14), FoxO1 (P = 0.0244 for 30 μM LA and P < 0.0001 for the rest) was the only gene to be positively regulated by all treatments. PPARGC1A was upregulated by LA at 100 (bar 12; P = 0.0025), 300 (bar 13; P < 0.0001), and 1,000 μM (bar 14; P < 0.0001), and 30 μM LA (bar 11) increased the expression of G6PC (P = 0.0003), whereas only 1,000 μM LA (bar 14) promoted expression of Sirt1 (P = 0.0080), FoxO3 (P < 0.0001), IDH2 (P < 0.0001), PRKAA1 (P < 0.0001), and PCK1 (P < 0.0001). A dose-dependent negative regulation was observed by 100 (bar 12) and 300 μM LA (bar 13) for Sirt1 (P = 0.0159 and P = 0.0254, respectively) and PRKAA1 (P < 0.0001 and P = 0.0079, respectively); by 30 (bar 11) and 100 μM LA (bar 12) for Sirt3 (P = 0.0186 and P = 0.0302, respectively); by 30 μM LA (bar 11) for PPARGC1A (P = 0.0436); and by 30 (bar 11), 100 (bar 12), and 300 μM LA (bar 13) for FoxO3 (P = 0.0023, P = 0.0084, and P = 0.0156, respectively) and IDH2 (P = 0.0004, P < 0.0001, and P = 0.0003, respectively). A summary of these results can be found in Table 2.


View Full Table | Close Full ViewTable 2.

Effect of the resveratrol (RSV) and lipoic acid (LA) treatments on gene expression in bovine liver slices1,2,3

 
Treatment Sirt1 Sirt3 PPARGC1A FoxO1 FoxO3 IDH2 PRKAA1 PCK1 G6PC
Restricted condition (KRB4) Control 882 11 8,212 169 205 2,942 63 29,950 162
40 μM RSV 156 1,071 441 369 219 159 73
80 μM RSV 128 584 80 284 305 160 58 39
30 μM LA 195 550 36 80 141 27 134
100 μM LA 40 55 23 228
300 μM LA 188 160 1,917 44 63 76 118
1,000 μM LA 163 2,354 52 61 69 58
Fed condition (propionate plus glucagon) Control 1,124 25 9,420 569 563 2,911 53 25,810 110
40 μM RSV 113 503 81 217 276 58
80 μM RSV 498 79 164 221 53
30 μM LA 26 91 163 32 60 27 442
100 μM LA 84 32 114 871 42 48 59 44
300 μM LA 86 149 1,669 47 58 77 87
1,000 μM LA 117 145 1,345 608 155 173 133
1The initial expression in the controls of the genes analyzed, presented as relative expression units.
2Changes in the expression of the genes analyzed are presented as the total percentage of the corresponding control.
3Only expressions with a P < 0.05 are presented.
4KRB = Krebs-Ringer buffer.

Effects of Resveratrol and Lipoic Acid Treatments on mRNA Expression of the Analyzed Genes in Bovine Muscle Slices

Treatment with RSV and LA prompted a different regulation pattern in muscle slices (Fig. 2; Table 3). Namely, RSV treatments under restricted conditions (Fig. 2, bars 2 and 3) had no effect on the expression of Sirt1 (P = 0.8066 and P = 0.9433, respectively) and PPARGC1A (P = 0.6699 and P = 0.7478, respectively); only 40 μM RSV (Fig. 2, bar 2) increased Sirt3 (P < 0.0001) expression, but it had the opposite effect on UCP3 (P < 0.0001). The expressions of both FoxO transcription factors (P < 0.0001 for both), IDH2 (P < 0.0001 for both ), PRKAA1 (P < 0.0001 and P = 0.0020, respectively), and FGF21 (P < 0.0001 for both) were all positively regulated by RSV at both concentrations.

Figure 2.
Figure 2.

Effects of resveratrol (RSV) and lipoic acid (LA) treatments on mRNA expression of the genes analyzed in bovine muscle slices. Relative expression levels (y-axis) of the mRNA for the genes studied were determined by quantitative real-time PCR in bovine muscle slices under restriction (Krebs-Ringer buffer [KRB]; bars 1–7) or with epinephrine (Epi) in KRB (bars 8–14). All gene expression levels were normalized to the geometric mean of the housekeeping genes ACTB and ribosomal protein L13a (RPL13A) by the 2–ΔΔCt method. Data from 6 animals are presented as the least squares means ± SEM. a–eDifferent lowercase letters indicate a significant difference between treatments under the same condition (restriction or Epi; P < 0.05). Treatments are as follows: Control (bars 1 and 8), 40 μM RSV (bars 2 and 9), 80 μM RSV (bars 3 and 10), 30 μM LA (bars 4 and 11), 100 μM LA (bars 5 and 12), 300 μM LA (bars 6 and 13), and 1,000 μM LA (bars 7 and 14).

 

View Full Table | Close Full ViewTable 3.

Effect of the resveratrol (RSV) and lipoic acid (LA) treatments on gene expression in bovine muscle slices1,2,3

 
Treatment Sirt1 Sirt3 PPARGC1A FoxO1 FoxO3 IDH2 PRKAA1 UCP3 FGF21
Restricted condition (KRB4) Control 362 16 2,873 940 570 3,740 35 7,411 313
40 μM RSV 194 159 180 155 153 72 159
80 μM RSV 169 201 129 140 169
30 μM LA 155 160 72 155
100 μM LA 321 131 255 122 133 110 66 122
300 μM LA 683 426 179 201 131 73 179
1,000 μM LA 1,483 1,073 213 230 127 69 213
Epinephrine treatment Control 286 24 2,453 862 460 3,320 30 6,886 732
40 μM RSV 208 139 156 193 130 155 80 156
80 μM RSV 79 133 131 131 67 133
30 μM LA 270 193 203 77 193
100 μM LA 213 118 153 159 74 153
300 μM LA 344 46 172 231 309 111 75 231
1,000 μM LA 211 128 143 62
1Initial expression in the controls of the genes analyzed, presented as relative expression units.
2Changes in the expression of the genes analyzed are presented as the total percentage of the corresponding control.
3Only expressions with a P < 0.05 are presented.
4KRB, Krebs-Ringer buffer.

Addition of epinephrine, the classical hormone activating glycogen catabolism in this tissue (Fig. 2, bars 8–14), in combination with RSV (bars 9 and 10) upregulated FoxO1 (P < 0.0001 and P = 0.0009, respectively), FoxO3 (P < 0.0001 and P = 0.0068, respectively), PRKAA1 (P < 0.0001 and P = 0.0069, respectively), and FGF21 (P < 0.0001 and P = 0.0009, respectively), whereas UCP3 (P < 0.0001 for both) was downregulated. At 40 μM RSV (bar 9), mRNA expression of Sirt3 (P = 0.0002), PPARGC1A (P < 0.0001), and IDH2 (P < 0.0001) was promoted, whereas 80 μM RSV (bar 10) decreased PPARGC1A (P = 0.0203) expression. There was no effect of RSV–epinephrine treatments on Sirt1 (P = 0.0604 and P = 0.9698, respectively) expression.

On the other hand, LA treatment alone (restricted condition; Fig. 2, bars 4–7) positively regulated FoxO1 (P = 0.0337 for 100 µM LA and P < 0.0001 for the rest.), FoxO3 (P = 0.0202 for 100 μM LA and P < 0.0001 for the rest), and FGF21 (P = 0.0337 for 100 μM LA and P < 0.0001 for the rest) but negatively regulated UCP3 (P < 0.0001 for all LA treatments). Expression of Sirt1, PPARGC1A, and IDH2 was increased by LA at 100 (bar 5; P = 0.0121, P = 0.0348, and P = 0.0047, respectively), 300 (bar 6; P < 0.0001 for all), and 1,000 μM (bar 7; P < 0.0001 for all). Expression of Sirt3 was enhanced by 100 μM LA (bar 6; P = 0.0036), and expression of IDH2 was decreased by 30 μM LA (bar 4; P = 0.0013).

Upon addition of epinephrine (Fig. 2, bars 11–14), only FoxO3 (P < 0.0001 for all LA treatments except 1,000 μM LA [P = 0.0003]) was upregulated, whereas UCP3 (P < 0.0001 for all) was downregulated by all LA treatments. The expression of Sirt1 was enhanced by LA at 30 (bar 11; P < 0.0001), 300 (bar 13; P < 0.0001), and 1,000 μM (bar 14; P < 0.0001); Sirt3 was increased by 100 μM LA (bar 12; P < 0.0001) but was negatively regulated by 300 μM LA (bar 13; P = 0.0452); PPARGC1A expression was promoted by LA at 100 (bar 12; P = 0.0379), 300 (bar 13; P < 0.0001), and 1,000 μM (bar 14; P = 0.0024); FoxO1 and FGF21 were both positively regulated by 30 (bar 11; P < 0.0001 for both), 100 (bar 12; P < 0.0001 for both), and 300 μM LA (bar 13; P < 0.0001 for both), whereas only 300 μM LA (bar 13) upregulated IDH2 (P = 0.0146). Neither LA alone (P = 0.8486, P = 0.1509, P = 0.9660, and P = 0.1819 for 30, 100, 300, and 1,000 μM LA, respectively) nor LA–epinephrine treatments (P = 0.2969, P = 0.8216, P = 0.5844, and P = 0.3266 for 30, 100, 300, and 1,000 μM LA, respectively) had any effect on PRKAA1 expression.

Expression of the Bovine Sirt1 Protein by Resveratrol and Lipoic Acid Treatments

Resveratrol treatments (Fig. 3, bars 2-3 and 9-10) had no effect on Sirt1 protein expression in either liver (Fig. 3A; P = 0.7683 and P = 0.8701 for bars 2-3 and P = 0.7629 and P = 0.6313 for bars 9-10 , respectively) or muscle slices (Fig. 3B; P = 0.4667 and P = 0.5900 for bars 2-3 and P = 0.3964 and P = 0.4794 for bars 9-10, respectively).

Figure 3.
Figure 3.

Expression of the bovine Sirt1 protein by resveratrol (RSV) and lipoic acid (LA) treatments. Western blot analysis was used to determine the expression of the Sirt1 protein in liver (A) and muscle (B). Rat liver (+) was used as the positive control for both tissues (upper panel). Quantification of the Sirt1 protein expression was made relative to ACTB using the ImageJ software (National Institutes of Health, Bethesda, MD; lower panel). Data from 6 animals are presented as the least squares means ± SEM. Different lowercase letters indicate a significant difference between treatments under the same condition (P < 0.05). Treatments are as follows: Control (bars 1 and 8), 40 μM RSV (bars 2 and 9), 80 μM RSV (bars 3 and 10), 30 μM LA (bars 4 and 11), 100 μM LA (bars 5 and 12), 300 μM LA (bars 6 and 13), and 1,000 μM LA (bars 7 and 14).

 

The protein expression for Sirt1 increased 4-fold in liver slices maintained under restricted conditions and incubated with 1,000 μM LA (Fig. 3A, bar 7; P = 0.0026). When propionate and glucagon were included in the incubation medium, 300 μM LA (Fig. 3A, bar 13; P = 0.0016) had the same positive effect. In the case of muscle slices, only 30 μM LA (Fig. 3B, bar 4; P = 0.0201) enhanced Sirt1 protein expression by 2.5-fold.


DISCUSSION

In our previous work (Ghinis-Hozumi et al., 2011), we obtained the expression profiles of Sirt1 and Sirt3 in liver, muscle, and adipose tissue from newborn calves and finishing bulls. With this data, the next step was to define the effect of treatments with RSV and LA, compounds known to activate both of these Sirt in nonruminant species (Shan et al., 2009; Chen et al., 2012; Valdecantos et al., 2012; Desquiret-Dumas et al., 2013). Both compounds have usually been incubated with cells for prolonged times (up to 48 h); although our incubation was for only 60 min, we observed an effect on the expression of mRNA for the genes studied and on the expression of the Sirt1 protein. The quick response observed in our results could be mainly due to the metabolic differences between ruminants and monogastric species. Treatment with 40 μM RSV in bovine liver slices resulted in a 56% increase in Sirt1 expression under restriction, and Shan et al. (2009) reported a 48% increase in porcine adipocytes after 24 h of incubation. In the case of LA, this compound had very variable effects on bovine liver and muscle slices compared with the gradual increases Chen et al. (2012) found from both the Fluor de Lys screening and the incubation with C2C12 myoblasts.

The effect of RSV and LA has been reported to be on the expression or activity or both of Sirt target genes (Baur, 2010; Valdecantos et al., 2012). However, in the present study, RSV had a negative and null effect on PPARGC1A expression in liver and muscle, respectively, whereas only the high doses of LA (100 to 1,000 μM) upregulated the expression of this coactivator in both tissues.

Resveratrol increases mitochondrial biogenesis and insulin sensitivity through the activation of Sirt1, which in turn activates PRKAA, lowering lipid accumulation (Hou et al., 2008). Activation of PRKAA decreases plasma glucose levels by repressing the expression of gluconeogenic enzymes (Yamauchi et al., 2002; Hardie, 2008) and, conversely, Sirt1 promotes gluconeogenesis by deacetylating PPARGC1A and FoxO1 (Chang and Guarente, 2014). Both PRKAA and Sirt1 regulate mitochondrial biogenesis by activating PPARGC1A through phosphorylation and deacetylation, respectively (Scarpulla, 2011; Mouchiroud et al., 2013).

Sirtuins induce the transcriptional activity of the FoxO transcription factors through deacetylation (Vetterli and Maechler, 2011; Olmos et al., 2013), whereas phosphorylation prevents their nuclear location and activation (Vetterli and Maechler, 2011).

Our results show that in liver slices, RSV treatment promotes an increase in the expression of genes involved in the regulation of mitochondrial function and antioxidant response and the regulation of reactive oxygen species homeostasis, including IDH2, which is deacetylated by Sirt3 (Someya et al., 2010; Smolková and Ježek, 2012).

It has been reported that Sirt1 and the complex Sirt3–FoxO3 upregulate PPARGC1A and, consequently, promote mitochondrial biogenesis (Tseng et al., 2013). Interestingly, we observed a negative effect on the expression of this and other genes. Therefore, it is probable that, under our experimental conditions, we might have promoted mitochondrial genome transcription instead of mitochondrial biogenesis (Peserico et al., 2013).

In the case of PCK1, fasting, glucagon, or an increase in FoxO1 and PPARGC1A expression promotes gluconeogenesis and, therefore, transcription of the PCK1 gene (Croniger et al., 2002). However, RSV treatment has also been reported to have a negative effect on PCK1 expression (Yang et al., 2009; Gao and Liu, 2013), as observed in our results.

Glucose homeostasis is improved in insulin-resistant animals through reduction of hepatic gluconeogenesis in the presence of Sirt1 activators, even when they increase FoxO1 and PPARGC1A activity (Liu et al., 2008). In this context, LA has been reported to downregulate this pathway (Yang et al., 2014) but the highest dose used in this work had the opposite effect.

In skeletal muscle, the upregulated genes promote fatty acid oxidation (Schrauwen et al., 2004; Bézaire et al., 2007; Chang and Guarente, 2014), mitochondrial function and energy expenditure (Camins et al., 2010), the cell response to oxidative stress (Bézaire et al., 2007; Olmos et al., 2013), muscle atrophy (Goodman et al., 2011; Lee and Goldberg, 2013), and protein turnover (Zhang et al., 2006).

The expression of UCP3 is downregulated, which is similar to what Amat et al. (2009) reported about Sirt1 activators. Fasting induces UCP3 mRNA and protein expression and, on β-adrenergic stimulation with epinephrine, it stimulates energy expenditure, increases fatty acid oxidation, and decreases reactive oxygen species levels (Bézaire et al., 2007; Nabben and Hoeks, 2008).

On the other hand, FGF21 is increased by fasting, and it regulates glucose uptake and lipolysis (Mashili et al., 2011); it is considered a starvation hormone, not a short-term fasting mediator (Potthoff et al., 2009). In this work, epinephrine had a positive effect on FGF21 mRNA expression, which is consistent with the study by Cuevas-Ramos et al. (2012).

In ruminants, the rate of gluconeogenesis increases after feeding; however, glucose release can be measured both under fed and fasted conditions (Nafikov and Beitz, 2007). In these species, gluconeogenesis has a different pattern of substrate utilization after feeding and during starvation (Lindsay, 1978). Additionally, feed restriction does not alter the mRNA levels of PCK1 in adult ruminants (Greenfield et al., 2000; Collier et al., 2008; Aschenbach et al., 2010), and it seems that pyruvate carboxylase is a more important regulator of gluconeogenesis in ruminants (Greenfield et al., 2000; Collier et al., 2008). Moreover, after the development of a functional rumen, gluconeogenesis becomes less sensitive to hormonal regulation (Baldwin et al., 2004), which could explain the minimal effects observed in our study.

Even though expression of the mRNA for PPARGC1A and PCK1 (in liver) or UCP3 (in muscle) was not positively regulated by the activator treatments, we observed (Supplemental Fig. S1; see the online version of the article at http://journalofanimalscience.org) that these genes had a high initial expression compared with the other genes analyzed. For instance, PCK1 had approximately 3 relative units of expression after the 60-min incubation, which is approximately the increase observed in starved mice (Valera et al., 1994) after a 24-h fast. In the case of PPARGC1A, the initial expression level after the incubation was approximately 0.8 relative units; although some of the treatments applied did not significantly upregulate its expression, PPARGC1A promotes gluconeogenesis and regulates glucose homeostasis, even though its expression is in the physiological range (Yoon et al., 2001).

In conclusion, we observed positive expression of genes involved in the antioxidant response in both tissues rather than the expected upregulation of genes related to gluconeogenesis and mitochondrial biogenesis. These results indicate that bovine Sirt respond differently to RSV and LA stimulation than monogastric Sirt do and that these enzymes do not regulate gluconeogenesis in ruminants to the same degree as they do in monogastric species. Our results provide information on the possible role of Sirt in ruminant metabolism; however, further research is necessary to better understand the role Sirt play in the regulation of glucose and lipid metabolism in ruminants.

 

References

Footnotes



Files:

Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.