View Full Table | Close Full ViewTable 1.

Real-time PCR primers for bovine target and housekeeping genes mRNA

 
Gene Gene number Primer sequence (5′ → 3′) Position Fragment size Tissue analyzed
Sirt1 XM_864818.2 Forward: ATACACTGGAGCAGGTT 1,031–1,047 164 bp Liver and Muscle
Reverse: TTCATCAGCTGGGCATCTAG 1,175–1,194
Sirt3 XM_873980.3 Forward: GCTAGGTTCCTGCTGCATCT 746–765 264 bp Liver and Muscle
Reverse: GATGAGGTCCTGGATGTCGT 990–1,009
PPARGC1A NM_177945.3 Forward: GTGAAGACCAGCCTCTTTGC 155–174 109 bp Liver and Muscle
Reverse: TCACTGCACCACTTGAGTCC 244–263
FoxO1 XM_583090.6 Forward: TCTTACGCCGACCTCATCACC 940–960 122 bp Liver and Muscle
Reverse: TTGCTGTCGCCCTTATCCTTG 1,041–1,061
FoxO3 NM_001206083.1 Forward: CTACGCCGATCTGATCACTCG 480–500 119 bp Liver and Muscle
Reverse: TGCTGTCGCCCTTATCCTTG 579–598
IDH2 NM_175790.2 Forward: CCACTATGCCGACAAGAGGA 177–196 170 bp Liver and Muscle
Reverse: CATTGGTCTGGTCACGGTTC 327–346
PRKAA1 BC153842.1 Forward: CCATGAAGAGAGCCACAATC 912–931 253 bp Liver and Muscle
Reverse: GCCTCGTTCATTATCCTCCT 1,145–1,164
PCK1 NM_174737.2 Forward: AACGCCATCAAGACCATCCA 1,174–1,193 141 bp Liver
Reverse: GTCCCACTCCTTGCCCTTC 1,296–1,314
G6PC NM_001076124.2 Forward: ATGTTGTGGTTGGGATTCTG 526–545 189 bp Liver
Reverse: CAGGAAGCAGGTGATGAGAA 695–714
UCP3 NM_174210.1 Forward: CCGTCAAGCAGTTCTACACC 499–518 210 bp Muscle
Reverse: CTCTGGCGATGGTCCTGT 691–708
FGF21 XM_002695200.2 Forward: CGGATCGCTGCACTTTGAC 624–642 76 bp Muscle
Reverse: CTGGTAGACGTTGTATCCATCTTCA 675–699
PPIA NM_017101.1 Forward: AGCACTGGGGAGAAAGGATT 160–179 248 bp Liver and Muscle
Reverse: AGCCACTCAGTCTTGGCAGT 388–407
YWHAZ NM_174814.2 Forward: CGGACACAGAACATCCAGT 34–52 242 bp Liver and Muscle
Reverse: TTTTCTCAGCACCTTCCGTCT 256–276
EEF1A1 NM_001402.5 Forward: TGCCCTTCTGTCTTACACC 471–489 166 bp Liver and Muscle
Reverse: CACAAATGCTACCGTGTCG 618–636
RPL13A NM_012423.3 Forward: CTGCCCCACAAGACCAAGC 347–366 179 bp Liver and Muscle
Reverse: TGGTACTTCCAGCCAACCTCA 505–525
RNA18S1 NR_036642.1| Forward: GGAGCGATTTGTCTGGGTTA 1,351–1,370 196 bp Liver and Muscle
Reverse: GTAGGGTAGGCACACGCTGA 1,527–1,546
ACTB NM_031144.3 Forward: CCATCATGAAGTGTGACGTTG 920–940 175 bp Liver and Muscle
Reverse: ACAGAGTACTTGCGCTCAGGA 1,074–1,094



View Full Table | Close Full ViewTable 2.

Effect of the resveratrol (RSV) and lipoic acid (LA) treatments on gene expression in bovine liver slices1,2,3

 
Treatment Sirt1 Sirt3 PPARGC1A FoxO1 FoxO3 IDH2 PRKAA1 PCK1 G6PC
Restricted condition (KRB4) Control 882 11 8,212 169 205 2,942 63 29,950 162
40 μM RSV 156 1,071 441 369 219 159 73
80 μM RSV 128 584 80 284 305 160 58 39
30 μM LA 195 550 36 80 141 27 134
100 μM LA 40 55 23 228
300 μM LA 188 160 1,917 44 63 76 118
1,000 μM LA 163 2,354 52 61 69 58
Fed condition (propionate plus glucagon) Control 1,124 25 9,420 569 563 2,911 53 25,810 110
40 μM RSV 113 503 81 217 276 58
80 μM RSV 498 79 164 221 53
30 μM LA 26 91 163 32 60 27 442
100 μM LA 84 32 114 871 42 48 59 44
300 μM LA 86 149 1,669 47 58 77 87
1,000 μM LA 117 145 1,345 608 155 173 133
1The initial expression in the controls of the genes analyzed, presented as relative expression units.
2Changes in the expression of the genes analyzed are presented as the total percentage of the corresponding control.
3Only expressions with a P < 0.05 are presented.
4KRB = Krebs-Ringer buffer.



View Full Table | Close Full ViewTable 3.

Effect of the resveratrol (RSV) and lipoic acid (LA) treatments on gene expression in bovine muscle slices1,2,3

 
Treatment Sirt1 Sirt3 PPARGC1A FoxO1 FoxO3 IDH2 PRKAA1 UCP3 FGF21
Restricted condition (KRB4) Control 362 16 2,873 940 570 3,740 35 7,411 313
40 μM RSV 194 159 180 155 153 72 159
80 μM RSV 169 201 129 140 169
30 μM LA 155 160 72 155
100 μM LA 321 131 255 122 133 110 66 122
300 μM LA 683 426 179 201 131 73 179
1,000 μM LA 1,483 1,073 213 230 127 69 213
Epinephrine treatment Control 286 24 2,453 862 460 3,320 30 6,886 732
40 μM RSV 208 139 156 193 130 155 80 156
80 μM RSV 79 133 131 131 67 133
30 μM LA 270 193 203 77 193
100 μM LA 213 118 153 159 74 153
300 μM LA 344 46 172 231 309 111 75 231
1,000 μM LA 211 128 143 62
1Initial expression in the controls of the genes analyzed, presented as relative expression units.
2Changes in the expression of the genes analyzed are presented as the total percentage of the corresponding control.
3Only expressions with a P < 0.05 are presented.
4KRB, Krebs-Ringer buffer.