View Full Table | Close Full ViewTable 1.

Primers and dual-labeled probe designs and product sizes used in the quantitative real-time PCR analyses of bovine α-tocopherol–associated genes and the housekeeping gene

 
Gene1 Sequence (5′ to 3′)2 Size, bp R2 Eff.,3 % Accession no.
α-TTP F: CACCGGCAGCAAAGTTCTGA 123 0.99 101 NM_001206676
P: AAGCTCCGACGTGATGAGACTCACACGA
R: TGTGTCTCTACCTCCTGGACAA
AFM F: TCTCCACTGAAGAACTGACCTTTC 119 0.99 98 NM_001192175
P: TCAACGCAGGCAAACTCTTCGCTCAGG
R: CTCTCCAAGAACTAAATCCACCAAA
SR-BI F: CTCTCCCATCCTCACTTCTACAAC 142 0.99 100 NM_174597
P: ACCCAGTCCTGGCAGAGGCAGTGTC
R: GCAGTTTCACAGAGCAGTTCATG
ABCA1 F: TGAGCACCCAGGAACTCTTAAAC 98 0.99 101 NM_001024693
P: TCCTTCCATACATCGGGTCCCAAAGCCA
R: CACCAAGCAGGGCGTTTCTG
TAP F: AGCAGGACTTGTTCAAGACCAA 149 0.99 98 NM_177943
P: CCCCATCTTCTCGGTCTGGCGGACAC AF432353
R: CGGCTTCCAGAGATGCTTGAG
CYP4F2 F: CCGGAGCATCACCAACGC 81 0.99 103 NM_001075322
P: CAGCTGCCATTGCACCCAAAGACATGC
R: TCCCCAAGCCAGGGTTTTAGA
ACTB F: TCGACACCGCAACCAGTTC 70 0.99 99 NM_173979
P: ACCACGAGCGCAGCAATATCATCATCCA BC102948
R: CATGCCGGAGCCGTTGTC
1α-TTP = α-tocopherol transfer protein; AFM = afamin; SR-BI = scavenger receptor class B, Type I; ABCA1 = ATP-binding cassette transporter A1; TAP = tocopherol-associated protein; CYP4F2 = cytochrome P450, family 4, subfamily F, polypeptide 2; ACTB = β-actin.
2F = forward primer; P = dual-labeled probe; R = reverse primer.
3Eff. = PCR efficiency.



View Full Table | Close Full ViewTable 2.

The tissue distributions of the mRNA expressions of α-tocopherol-associated genes in 20 different tissue types for the no α-tocopherol supplement (control [CONT]) group

 
mRNA expression level, arbitrary units1
Tissue α-TTP AFM SR-BI ABCA1 TAP CYP4F2
Liver 294.31a 208,652.9a 3.60c 19.69a 4,238.19a 10,357.22a
Testis 3.80b 16.0b 31.99b 1.69b 99.84b 8,995.88a
Adrenal gland 0.36b ND2 55.15a 3.51b 8.49b 6,007.56b
Thymus 0.01b 0.9b 0.55c 2.04b 168.61b 3.00c
Spleen 0.47b ND 1.37c 3.66b 6.79b 0.51c
Lymph node 0.04b ND 0.70c 1.81b 3.04b ND
Rumen 11.26b ND 0.34c 1.66b 1.87b 193.65c
Reticulum 6.60b ND 0.23c 1.18b 2.75b 132.04c
Omasum 1.73b ND 0.68c 1.51b 4.71b 5.34c
Abomasum 0.14b ND 0.43c 1.50b 45.18b 0.40c
Duodenum 0.04b 0.8b 0.92c 0.57b 153.91b 920.63c
Jejunum 0.02b 1.0b 1.00c 1.00b 136.13b 776.50c
Ileum 0.06b ND 0.52c 1.41b 39.25b 63.68c
Cecum 0.36b ND 0.25c 0.63b 1.22b 0.35c
Colon 1.00b ND 0.35c 1.08b 1.00b 1.00c
Renal cortex 0.55b 156.3b 0.88c 2.39b 10.76b 93.72c
Lung 3.74b ND 0.47c 3.51b 0.77b 0.09c
Skeletal muscle 0.34b ND 2.11c 3.61b 2.52b 97.63c
Heart muscle 0.72b ND 0.96c 5.47b 17.68b 0.47c
Adipose 32.6b ND 1.30c 4.93b 3.40b 7.50c
SEM 6.75 15,204.6 1.42 0.46 95.38 337.80
a–cSignificant differences (adjusted P < 0.05) among the values for each gene in the 20 tissues of the CONT group (n = 5).
1Messenger RNA expression levels of all genes were normalized to β-actin mRNA levels and expressed relative to the mRNA abundance in the jejunum (for afamin [AFM], scavenger receptor class B, Type I [SR-BI], and ATP-binding cassette transporter A1 [ABCA1]) and colon (for α-tocopherol transfer protein [α-TTP], tocopherol-associated protein [TAP], and cytochrome P450, family 4, subfamily F, polypeptide 2 [CYP4F2]).
2ND = not detected (after amplification in almost all samples).



View Full Table | Close Full ViewTable 3.

The tissue distributions of the mRNA expressions of α-tocopherol–associated genes in 20 tissue types for the α-tocopherol–supplemented group (TOC1)

 
mRNA expression level, arbitrary units2
Tissue α-TTP AFM SR-BI ABCA1 TAP CYP4F2
Liver 333.57a 392,790.5a 3.59c 19.85a 4,833.31a 8,591.14a
Testis 1.70b 9.0b 19.19b 1.82def 97.90b 5,412.32b
Adrenal gland 0.15b ND3 53.91a 4.12be 7.51b 3,769.89b
Thymus 0.02b 2.3b 0.38c 2.20cdef 172.48b 1.99c
Spleen 0.50b ND 1.01c 4.13be 7.72b 0.28c
Lymph node 0.02b ND 0.46c 2.63cdef 3.86b ND
Rumen 11.03b ND 0.27c 1.76def 2.46b 148.02c
Reticulum 7.91b ND 0.16c 1.10ef 3.00b 98.92c
Omasum 1.87b ND 0.83c 1.63def 6.81b 4.78c
Abomasum 0.18b ND 0.30c 2.14cdef 82.72b 0.79c
Duodenum 0.09b 1.1b 0.48c 0.94ef 96.92b 208.54c
Jejunum 0.01b 1.0b 1.00c 1.00ef 204.92b 1,177.01c
Ileum 0.04b ND 0.49c 2.01def 15.13b 24.88c
Cecum 0.31b ND 0.19c 0.60f 1.34b 0.40c
Colon 1.00b ND 0.25c 1.08ef 1.00b 1.00c
Renal cortex 1.13b 418.1b 0.69c 2.39cde 4.02b 60.80c
Lung 2.63b ND 0.61c 5.40bc 1.32b 0.11c
Skeletal muscle 0.26b ND 1.64c 1.84de 2.24b 74.66c
Heart muscle 0.98b ND 0.76c 6.31b 17.76b 0.39c
Adipose 28.03b ND 0.88c 4.54bd 2.88b 1.82c
SEM 7.55 27,970.1 1.28 0.43 107.74 246.16
a–fSignificant differences (adjusted P < 0.05) among the values for each gene in the 20 tissues of the TOC group (n = 5).
1TOC group, in which calves were orally administered α-tocopherol (30 IU∙kg–1 BW∙d–1) for 2 wk (n = 5).
2Messenger RNA expression levels of all genes were normalized to β-actin mRNA levels and expressed relative to the mRNA abundance in the jejunum (for afamin [AFM], scavenger receptor class B, Type I [SR-BI], and ATP-binding cassette transporter A1 [ABCA1]) and colon (for α-tocopherol transfer protein [α-TTP], tocopherol-associated protein [TAP], and cytochrome P450, family 4, subfamily F, polypeptide 2 [CYP4F2]).
3ND = not detected (after amplification in almost all samples).



View Full Table | Close Full ViewTable 4.

Comparison values for the relative mRNA levels of α-tocopherol transfer protein (α-TTP) and afamin (AFM) in 20 tissue types with and without α-tocopherol supplement

 
α-TTP mRNA, arbitrary units1
AFM mRNA, arbitrary units
Tissue CONT2 TOC3 SEM P-value4 CONT TOC SEM P-value
Liver 1.00 1.38 0.13 0.15 1.00 1.58 0.12 0.004
Testis 1.00 0.55 0.18 0.23 1.00 0.47 0.15 0.08
Adrenal gland 1.00 0.50 0.18 0.16 ND5 ND
Thymus 1.00 1.61 0.26 0.26 1.00 2.09 0.38 0.16
Spleen 1.00 1.28 0.10 0.18 ND ND
Lymph node 1.00 0.80 0.15 0.53 ND ND
Rumen 1.00 1.20 0.07 0.20 ND ND
Reticulum 1.00 1.46 0.12 0.047 ND ND
Omasum 1.00 1.32 0.16 0.35 ND ND
Abomasum 1.00 1.54 0.16 0.08 ND ND
Duodenum 1.00 3.12 0.45 0.008 1.00 1.18 0.25 0.73
Jejunum 1.00 0.96 0.15 0.91 1.00 0.84 0.16 0.64
Ileum 1.00 0.70 0.21 0.52 ND ND
Cecum 1.00 1.04 0.15 0.90 ND ND
Colon 1.00 1.22 0.11 0.36 ND ND
Renal cortex 1.00 2.50 0.35 0.02 1.00 2.24 0.36 0.11
Lung 1.00 0.86 0.13 0.62 ND ND
Skeletal muscle 1.00 0.96 0.15 0.89 ND ND
Heart muscle 1.00 1.67 0.16 0.03 ND ND
Adipose 1.00 1.05 0.17 0.90 ND ND
1Gene mRNA levels are expressed relative to the mRNA abundance in the CONT group.
2CONT group = control; calves did not received α-tocopherol supplement (n = 5).
3TOC group, in which calves were orally administered α-tocopherol (30 IU∙kg–1 BW∙d–1) for 2 wk (n = 5).
4P-value of the comparison between 2 groups by Student’s t test.
5ND = not detected (after amplification in almost all samples).



View Full Table | Close Full ViewTable 5.

Comparison values for the relative mRNA levels of scavenger receptor class B, Type I (SR-BI) and ATP-binding cassette transporter A1 (ABCA1) in 20 tissue types with and without α-tocopherol supplement

 
SR-BI mRNA, arbitrary units1
ABCA1 mRNA, arbitrary units
Tissue CONT2 TOC3 SEM P-value4 CONT TOC SEM P-value
Liver 1.00 1.28 0.07 0.048 1.00 0.90 0.11 0.67
Testis 1.00 0.77 0.21 0.61 1.00 0.96 0.15 0.90
Adrenal gland 1.00 1.26 0.08 0.10 1.00 1.05 0.09 0.81
Thymus 1.00 0.89 0.05 0.29 1.00 0.96 0.09 0.84
Spleen 1.00 0.95 0.03 0.46 1.00 1.01 0.06 0.95
Lymph node 1.00 0.84 0.07 0.28 1.00 1.04 0.18 0.37
Rumen 1.00 1.02 0.09 0.94 1.00 0.95 0.08 0.76
Reticulum 1.00 0.89 0.06 0.41 1.00 0.83 0.10 0.41
Omasum 1.00 1.57 0.26 0.29 1.00 0.97 0.13 0.91
Abomasum 1.00 0.88 0.07 0.43 1.00 1.28 0.20 0.52
Duodenum 1.00 0.67 0.12 0.16 1.00 1.46 0.15 0.13
Jejunum 1.00 1.28 0.25 0.60 1.00 0.89 0.14 0.74
Ileum 1.00 1.19 0.16 0.57 1.00 1.28 0.15 0.39
Cecum 1.00 0.98 0.13 0.94 1.00 0.85 0.15 0.66
Colon 1.00 0.92 0.07 0.59 1.00 0.90 0.13 0.71
Renal cortex 1.00 1.02 0.04 0.82 1.00 0.89 0.06 0.42
Lung 1.00 1.66 0.21 0.12 1.00 1.30 0.14 0.34
Skeletal muscle 1.00 1.00 0.06 0.99 1.00 0.46 0.24 0.29
Heart muscle 1.00 1.01 0.05 0.89 1.00 1.03 0.07 0.84
Adipose 1.00 0.86 0.11 0.56 1.00 0.82 0.14 0.57
1Gene mRNA levels are expressed relative to the mRNA abundance in the CONT group.
2CONT group = control; calves did not received α-tocopherol supplement (n = 5).
3TOC group, in which calves were orally administered α-tocopherol (30 IU∙kg–1 BW∙d–1) for 2 wk (n = 5).
4P-value of the comparison between 2 groups by Student’s t test.



View Full Table | Close Full ViewTable 6.

Comparison values for the relative mRNA levels of tocopherol-associated protein (TAP) and cytochrome P450, family 4, subfamily F, polypeptide 2 (CYP4F2) in 20 tissue types with and without α-tocopherol supplement

 
TAP mRNA, arbitrary units1
CYP4F2 mRNA, arbitrary units
Tissue CONT2 TOC3 SEM P-value4 CONT TOC SEM P-value
Liver 1.00 1.14 0.08 0.45 1.00 1.19 0.08 0.27
Testis 1.00 0.98 0.12 0.94 1.00 0.86 0.08 0.42
Adrenal gland 1.00 0.88 0.18 0.76 1.00 0.90 0.12 0.70
Thymus 1.00 1.02 0.06 0.88 1.00 0.95 0.12 0.86
Spleen 1.00 1.14 0.06 0.32 1.00 0.80 0.13 0.49
Lymph node 1.00 1.27 0.10 0.20 ND5 ND
Rumen 1.00 1.31 0.09 0.08 1.00 1.10 0.13 0.73
Reticulum 1.00 1.09 0.04 0.25 1.00 1.08 0.12 0.77
Omasum 1.00 1.45 0.12 0.07 1.00 1.28 0.29 0.66
Abomasum 1.00 1.83 0.28 0.14 1.00 2.86 0.79 0.30
Duodenum 1.00 0.63 0.12 0.11 1.00 0.33 0.21 0.11
Jejunum 1.00 1.50 0.23 0.30 1.00 2.18 0.57 0.33
Ileum 1.00 0.39 0.22 0.18 1.00 0.56 0.20 0.30
Cecum 1.00 1.10 0.14 0.74 1.00 1.67 0.31 0.30
Colon 1.00 1.00 0.14 1.00 1.00 1.44 0.28 0.46
Renal cortex 1.00 0.37 0.14 0.01 1.00 0.93 0.10 0.75
Lung 1.00 1.70 0.20 0.07 1.00 1.77 0.30 0.25
Skeletal muscle 1.00 0.89 0.10 0.59 1.00 1.10 0.22 0.84
Heart muscle 1.00 1.00 0.12 0.99 1.00 1.19 0.33 0.79
Adipose 1.00 0.85 0.06 0.21 1.00 0.35 0.42 0.47
1Gene mRNA levels are expressed relative to the mRNA abundance in the CONT group.
2CONT group = control; calves did not received α-tocopherol supplement (n = 5).
3TOC group in which calves were orally administered α-tocopherol (30 IU∙kg–1 BW∙d–1) for 2 wk (n = 5).
4P-value of the comparison between 2 groups by Student’s t test.
5ND = not detected (after amplification in almost all samples).



View Full Table | Close Full ViewTable 7.

Serum α-tocopherol (α-Toc) concentrations, α-Toc contents in 20 tissue types and mean increase value of α-Toc after oral α-Toc administration

 
α-Toc levels
Mean increase value,3 -fold
Tissue CONT1 TOC2
Serum, μg/mL 0.70 5.45 7.8DE
Tissues, μg/g of wet tissue
    Liver 1.00b 23.16b 23.1BC
    Testis 5.20a 41.11a 7.9DE
    Adrenal gland 1.71b 21.52b 12.6CD
    Thymus 0.38b 1.99de 5.2DE
    Spleen 0.64b 8.35cde 13.1CD
    Lymph node 1.21b 14.93bc 12.3CD
    Rumen 0.33b 2.13de 6.4DE
    Reticulum 0.34b 2.35de 6.8DE
    Omasum 0.37b 1.78de 4.8DE
    Abomasum 1.01b 4.46cde 4.4DE
    Duodenum 0.52b 13.79bcd 26.3B
    Jejunum 0.92b 37.61a 40.7A
    Ileum 0.61b 4.33cde 7.1DE
    Cecum 0.63b 5.25cde 8.4DE
    Colon 0.54b 4.37cde 8.0DE
    Renal cortex 0.99b 5.34cde 5.4DE
    Lung 1.22b 6.46cde 5.3DE
    Skeletal muscle 0.55b 0.77e 1.4E
    Heart muscle 1.18b 2.61cde 2.2DE
    Adipose 0.69b 1.85de 2.7DE
    SEM 0.14 1.25 1.0
a–eSignificant differences (P < 0.05) among values in each tissue within the same group.
A–ESignificant differences (P < 0.05) among the mean increase values for each tissue and serum.
1CONT group = control; calves did not received α-tocopherol supplement (n = 5).
2TOC group, in which calves were orally administered α-Toc (30 IU∙kg–1 BW∙d–1) for 2 wk (n = 5).
3Increase in value = α-Toc content of N1 in N2/mean α-Toc content of N1 in the CONT group, in which N1 is each tissue species of 20 or serum and N2 is the individual in the TOC group (n = 5).