Search
Author
Title
Vol.
Issue
Year
1st Page

Journal of Animal Science - Animal Products

Effect of different dietary energy on collagen accumulation in skeletal muscle of ram lambs1

 

This article in JAS

  1. Vol. 93 No. 8, p. 4200-4210
     
    Received: Mar 22, 2015
    Accepted: May 29, 2015
    Published: August 3, 2015


    3 Corresponding author(s): sxndzjx@163.com
 View
 Download
 Share

doi:10.2527/jas.2015-9131
  1. J. X. Zhao22,
  2. X. D. Liu22,
  3. J. X. Zhang,
  4. W. Y and
  5. H. Q Li 3
  1. College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu, Shanxi 030801, P. R. China

Abstract

Tenderness is one of the most appreciated characteristics of meat quality. The objective of this trial was to investigate the effect of different energy diets on collagen deposition and meat tenderness. Twelve one-half Dorper × one-half small thin-tailed sheep crossed ram lambs (20 ± 0.5 kg of BW) were randomly selected and divided into 2 groups in a completely randomized design. Animals were offered identical diets at 100 or 65% of ad libitum intake. Lambs were euthanized when BW in the ad libitum group reached 35 kg, and the semitendinosus (ST) muscle were sampled. The results showed that Warner–Bratzler shear force (WBSF) was significantly increased when lambs were fed an energy-restricted diet (P < 0.05). Masson trichrome stain and hydroxyproline assay demonstrated increased collagen content in ST muscle of feed restriction lambs. Both collagen I and fibronectin mRNA contents were significantly increased when lambs were fed an energy-restricted diet (P < 0.05), whereas no difference for collagen III mRNA expression was observed (P > 0.05). Expression of prolyl 4-hydroxylase α (P4HA) was greater in the feed restriction group (P < 0.01), and no differences were observed for both lysyl oxidase (LO) and lysyl hydroxylase 2b (LH2b) mRNA contents (P > 0.05). In addition, matrix metalloproteinase 1, 2, 9, and 13 (MMP1, MMP2, MMP9, and MMP13) did not change with the feed restriction, whereas both tissue inhibitor of matrix metalloproteinase 1 and 2 (TIMP1 and TIMP2) were increased. Feed restriction did not alter TGF-β and SMAD protein contents, but phosphor-p38 protein content was elevated. In summary, feed restriction enhanced collagen accumulation in ST muscle, which may negatively affect the lamb tenderness, and was associated with the upregulated p38 signaling pathway.



INTRODUCTION

Tenderness is one of the most appreciated characteristics of meat quality (Silva et al., 2010) and depends on various factors, including breed, gender, age, and slaughter and maturation conditions (Santos-Silva et al., 2002; Hopkins and Mortimer, 2014). In beef cattle, inconsistency of tenderness is one of the major factors affecting consumer satisfaction. Collagen is a major component of connective tissue. It is well established that quantity and quality of the intramuscular collagen content and solubility contribute to the background of postmortem meat tenderness (Lepetit, 2008). Animal management is important in determining meat tenderness (Therkildsen et al., 2008). However, whether diet will affect collagen contents is contradictory. Some researchers demonstrate that animals fed with high-energy diets before slaughter may have reduced total collagen contents and increased soluble collagen, which further positively affect meat tenderness (Cranwell et al., 1996; Schnell et al., 1997; Kristensen et al., 2002), whereas other studies failed to demonstrate such effects (Sami et al., 2004; Serrano et al., 2007). The small thin-tailed sheep is an indigenous sheep breed of China. Recently, the Dorper breed sheep has been widely used as terminal sire breed to improve growth performance and carcass traits, and the Dorper × small thin-tailed crossed sheep has become the dominant breed for lamb production in Shanxi province, which is located in the north of China. In this region, drought is a recurring meteorological phenomenon, which results in significant reduction in forage production (Hou et al., 2008). Thus, lambs in this area frequently experience nutrient restriction. We hypothesize that collagen content and meat tenderness in lambs are affected by drought. The aim of the present study is to evaluate the effects of different dietary energy levels on collagen deposition in semitendinosus (ST) muscle from Doper × small thin-tailed crossed ram lambs.


MATERIALS AND METHODS

Care and Use of Animal

All animal procedures were approved by the Shanxi Agricultural University Animal Care and Ethical Committee. Twelve one-half Dorper × one-half small thin-tailed sheep crossed ram lambs (20 ± 0.5 kg of BW) were randomly selected and housed in individual stalls (3.0 by 0.8 m) equipped with feeders and a water source. Animals were injected with ivermectin at a dosage of 0.2 mg/kg of BW to eliminate internal parasites. Ram lambs were individually fed a diet at either 100% of the NRC recommendation for energy (ad libitum) or 65% of the NRC’s recommendation (NCR, 2007). Feed was formulated as a pelleted mixed diet, and ingredients and nutrient contents are shown in Table 1. Lambs were fed twice daily at 0800 and 1800 h and had free access to clean water and salt block throughout experiment. Feed supplied to the ad libitum group was adjusted daily in the morning according to DMI of the previous day to make sure 10% remained. Feed offered to restricted groups was adjusted based on DMI of the ad libitum group from the previous day.


View Full Table | Close Full ViewTable 1.

Ingredient and chemical composition of the mixed diet

 
Dietary ingredient Percent
Corn stalk 34.0
Sunflower seed null 11.0
Corn grain 27.3
Soybean meal 9.0
Rapeseed dregs 5.2
Distiller’s dried grain with solubles 6.1
Wheat bran 5.0
Salt 0.6
Mineral/vitamin premix 1.8
Total 100
Chemical composition (determined)
    DM, % as fed 91.88
    GE, MJ/kg of DM 17.29
    CP, % of DM 7.8
    NDF, % of DM 41.3
    Ash, % DM 5.81
    Ca, % of DM 0.54
    P, % of DM 0.38

When lambs in the ad libitum group reached 35 kg of BW, all animals were anesthetized by inhaling CO2. The ST muscle from left side was removed and surface tissues were trimmed; 1 piece of muscle was sampled at the anatomic center and snap-frozen in liquid nitrogen for further use, another piece was fixed in 4% paraformaldehyde (PFA) for paraffin embedding, and remaining ST muscle was for Warner–Bratzler shear force (WBSF) determination after aging.

Masson Trichrome Stain

Unless stated otherwise, all chemicals are of analytical grade. Masson trichrome stain was performed as previous described (Foidart et al., 1981). Briefly, ST muscle fixed by 4% PFA (pH 7.4) was serially dehydrated in ethanol and xylene and embedded in paraffin. The block was sectioned at 7 μm by a microtome (Leica, Wetzlar, Germany). Then, sections were dewaxed and serially rehydrated by incubations with xylene and different concentration of ethanol. After that, sections were subjected to trichrome staining for histological examination, which stained muscle fiber red, nuclei black, and collagen blue. Slides were observed under a microscope (Nikon, Gotenba, Shizuoka Prefecture, Japan), and 10 fields of each sample were randomly selected for collagen content quantification using Image J (National Institutes of Health, Bethesda, MD).

Collagen Concentration Analysis

Semitendinosus muscles were ground in liquid nitrogen, and 100 mg powder was weighed out and dried in oven at 60°C. After that, samples were hydrolyzed using 1 mL of 6 N HCl and placed in an oven set at 110°C for approximately 18 h. An aliquot was removed for hydroxyproline determination using the procedure described by Woessner (1961). Briefly, 1 mL of hydrolysates were oxidized with 500 μL of freshly prepared chloramine T hydrate and allowed to react for 30 min. After that, 500 μL of perchloric acid was added into each tube and allowed to react for 5 min. Then, 500 μL of p-dimethylaminobenzaldehyde solution was added and the tubes were incubated in 60°C water bath for 20 min, during which time red chromophores developed. The samples were cooled in an ice-water bath for 5 min. Absorbance was read immediately at 557 nm in a spectrophotometer (Synergy H1 Multi-Mode Reader; Bio-Tek, Winooski, VT). The amount of hydroxyproline determined from assay was converted to micrograms of collagen per milligram of muscle sample using the conversion factor 7.25, according to a previous report (Zimmerman et al., 2001).

Intramuscular Fat Content Analysis

Intramuscular fat (IMF) content was determined using the Soxhlet petroleum-ether extraction method according to a previous report (Zhang et al., 2014). Briefly, ST muscles were lyophilized to constant weight and then were subjected to ether extraction using a Soxhlet apparatus and diethyl ether. After 8 h extraction, samples were removed, air dried, and reweighed to determine fat loss.

Muscle Fiber Size Distribution Analysis

Myofiber cross-sectional area analysis was performed as previously described (White et al., 2009). Five slides per sample from Masson trichrome staining were taken for analysis using Image J (National Institutes of Health), and approximated 200 individual myofibers were measured per muscle. All fibers in the cross-sectional images were quantified, unless the sarcolemma was not intact.

Warner–Bratzler Shear Force Measurement

Warner–Bratzler shear force was determined based on the protocol for beef tenderness measurement. Briefly, after aging for 14 d, 2.54-cm-thick steaks were cut from ST muscle and cooked according to guidelines for WBSF. All steaks were cooked in oven set at 177°C, and internal steak temperature was monitored by digital thermometer. After center temperature reached 70°C, samples were removed and cooled to room temperature. Then, steaks were placed in individual bags and chilled for 24 h at 1°C. After that, 6 cylindrical cores (1.27 cm diameter) were removed from each steak using a drill press mounted corer, with the axis parallel to the muscle fibers. Warner–Bratzler shear forces were measured by a shear force instrument (Mecmesin, West Sussex, UK). The average shear force and SD were calculated for each sample.

Real-Time Quantitative PCR

Total RNA was extracted using Trizol reagent (Sigma, St. Louis, MO) followed by deoxyribonuclease treatment, and cDNA was synthesized using a reverse transcription kit (TAKARA Co., Ltd., Dalian, China). Real-time quantitative PCR (RT-PCR) was performed using a CFX RT-PCR detection system (Bio-Rad, Hercules, CA) with a SYBR Green RT-PCR kit from TAKARA Co., Ltd. The following cycle parameters were used: 36 3-step cycles of 95°C for 20 s, 55°C for 20 s, and 72°C for 20 s. Primers are listed in Table 2. After amplification, a melting curve (0.01°C/sec) was used to confirm products’ purity and agarose gel electrophoresis was performed to confirm the targeted size. Relative mRNA content was normalized to the RPL13 content (Keller et al., 2014).


View Full Table | Close Full ViewTable 2.

Primer sequences for real-time PCR

 
Name Sequence (5′–3′) Length, bp
Collagen I GACATCCCACCAGTCACCTG
GGGACTTTGGCGTTAGGACA
161
Collagen III AGGGCAGGGAACAACTGATG
ACAGTGGGATGAAGCAGAGC
145
Fibronectin ACCCTGGGTATGACACTGGA
CATTCGGCGGATACGGTCTT
165
MMP1 CAGAGAAACGGTGGCCTCAT
CAGTCACTCTCAGCCCGAAG
70
MMP2 AACGGCAAGGAGTACACCAG
AGAAGCCATACTTGCCGTCC
103
MMP9 TAGATCACTCCTCCGTGCCA
GGGCGAGGACCATACAGATG
115
TIMP1 TGCTGCTGGTTGTGAGGAAT
CCACAAGCAATGAGTGTCGC
82
TIMP2 TGGACTCTGGCAACGACATC
TCCTGGTCAGGTCCCTTGAA
91
TIMP3 TACCCTGGCTACCAGTCCAA
CAGGGGTCTGTGGCATTGAT
116
LO CCCAGCTATTTGGTGCCTGA
GTGAAATTGTGCAGCCCGAG
103
LH2b GTCTGCTCTGAGCCTTAAAACAC
TGTCACTTGTACATCTGTACCTGAA
152
P4Hb ACAGAAAGATGAGCCAGATGCT
CAGCAGTTCCCTTTTTGGGC
149
RPL 13 GCAAAAAGGGCCAAGGAAGC
CAAAGGTCAGACACACCCCA
155

Antibodies

Antibodies against TGF-β (number 3711), p38 (number 9212), phosphor-p38 (number 9211), Smad2/3 (number 3102), and phosphor-Smad2/3 (number 9520) were purchased from Cell Signaling (Danvers, MA). β-Actin (number AB10024) and donkey anti-rabbit secondary antibody (number AB10056) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China).

Western Blotting

Semitendinosus muscle powdered in liquid nitrogen was used for western blotting analyses as described previously (Zhao et al., 2010). Briefly, a muscle sample (0.1 g) was homogenized in 500 μL of ice-cold lysis buffer containing 137 mM NaCl, 50 mM HEPES, 2% SDS, 1% NP-40, 10% glycerol, 2 mM phenylmethylsulfonyl fluoride, 10 mM sodium pyrophosphate, 10 μg/mL of aprotinin, 10 μg/mL of leupeptin, 2 mM Na3VO4, and 100 mM NaF. Muscle homogenate was centrifuged for 15 min at 12,000 × g at 4°C, for soluble protein separation, and protein concentration of the lysates was determined by BCA Protein Assay Kit (Sangon Biotech Co., Ltd.). After that, the sample was mixed with an equal volume of 2x sample loading buffer (37 mM Tris-HCl pH 6.8, 4.4% SDS, 2.2% glycerol, and 0.002% bromophenol blue) and 5% mercaptoethanol. The mixture was boiled and used for electrophoresis.

Proteins separated by SDS-PAGE were transferred to nitrocellulose membranes and blocked with blocking buffer (Sangon Biotech Co., Ltd.) for 1 h. After that, membranes were incubated with primary antibodies in a 1:1,000 dilution (vol/vol) at 4°C overnight. Membranes were washed with Phosphate Buffered Saline with Tween 20 (PBST) 4 times for 5 min each, incubated with secondary antibody for 1 h at room temperature, and washed with PBST 4 times for 5 min each. Finally, membranes were subjected to EasyBlot ECL kit (Sangon Biotech Co., Ltd.) and scanned with Gel Doc XR+ (Bio-Rad). Density of bands was quantified and normalized to β-actin contents.

Statistical Analysis

Statistical analysis was performed using SAS 9.0 (SAS Inst. Inc., Cary, NC). Six lambs were used in each group and each animal was considered an experimental unit. Data was expressed as means ± SEM and analyzed using Student’s test. Probability < 0.05 was considered as statistical significance in all data.


RESULTS

Growth and Slaughter Performance

As shown in Table 3, there was no difference for initial BW between the 2 groups (P = 0.58), whereas both final BW and net weight gain were significantly decreased by feed restriction (P < 0.0001). Lambs fed ad libitum had greater DMI and gain daily than the restricted feed intake group (P < 0.0001); the ratio of feed to gain was significantly increased by feed restriction (P < 0.05). After lambs were slaughtered, carcass and meat were weighed, and data showed that both carcass and meat weight were decreased by feed restriction.


View Full Table | Close Full ViewTable 3.

Effect of different dietary energy levels on growth and slaughter performance of Dorper × small thin-tailed lamb

 
Level of intake1
Item AL 65% SEM P-value
No. of lambs 6 6
Initial BW, kg 19.23 18.97 0.45 0.5817
Final BW, kg 35.12 28.42 0.27 <0.0001
Net gain, kg 15.89 9.45 0.48 <0.0001
ADG, g 248.30 147.70 7.52 <0.0001
DM intake, g/d 1,292.00 862.56 30.30 <0.0001
Feed:gain, g/g 5.21 5.84 0.28 0.0459
Carcass, kg 16.61 12.71 0.42 <0.0001
Meat weight, kg 10.55 8.21 0.44 0.0002
1AL = ad libitum; 65% = 65% of ad libitum feed intake.

Warner–Bratzler Shear Force and Collagen Content

As shown in Fig. 1, the WBSF was significantly increased when animals were subjected to feed restriction (P < 0.05). Collagen content in ST muscle was analyzed by Masson trichrome stain. Increased collagen content was histochemically detected in ST muscle from feed restricted lamb compared with ad libitum lamb (Fig. 2A, 2B, and 2C). Collagen content was also directly measured by determining hydroxyproline concentration, and data showed that feed restriction was associated with increased collagen content in ST muscle (Fig. 2D). Collagen I and collagen III are the most abundant collagen types in skeletal muscle. The mRNA expression of collagen I, collagen III, and fibronectin in ST muscle were determined by real-time PCR (Fig. 2E). Both collagen I and fibronectin mRNA expression were significantly increased when lambs were fed the restricted diet (P < 0.05), whereas there was no difference for collagen III mRNA expression between the 2 groups.

Figure 1.
Figure 1.

Warner–Bratzler shear force (WBSF) in semitendinosus (ST) muscle of ad libitum (□) and feed restriction (■) ram lambs. Semitendinosus muscle was sampled, aging for 14 d, and cooked at 177°C. Warner–Bratzler shear force was measured by a shear force instrument (Mecmesin, West Sussex, UK). Data showed that WBSF in ST muscle was increased by feed restriction. *P < 0.05. (Mean ± SEM; n = 6 in each group.)

 
Figure 2.
Figure 2.

Collagen deposition in semitendinosus (ST) muscle of ad libitum (□) and feed restriction (■) ram lambs. (A and B) Trichrome staining analysis showed that more collagen was deposited in ST muscle when animal were fed with restricted feed. (C) Hydroxyproline determination assay further confirmed the increased collagen contents in feed restricted ST muscle. (D) Real-time PCR indicated that both collagen I and fibronectin mRNA contents were increased by feed restriction, whereas no change was observed for collagen III. **P < 0.01; *P < 0.05. (Mean ± SEM; n = 6 in each group.)

 

Muscle Fiber Area, Size Distribution, and Intramuscular Fat Contents

The change of muscle structure may affect intramuscular collagen deposition. To explore whether muscle structure was altered by feed restriction, we determined muscle fiber area and size distribution and IMF contents between the 2 groups. The results indicated that feed restriction affected muscle fiber size distribution (Fig. 3A) and significantly reduced myofiber area (Fig. 3B; P < 0.05). In addition, IMF content was not changed (Fig. 3C).

Figure 3.
Figure 3.

Muscle fiber area, size distribution, and intramuscular fat (IMF) content in semitendinosus muscle of ad libitum (□) and feed restriction (■) ram lambs. Data showed that muscle fiber area was reduced by feed restriction (A and B), whereas no change of IMF contents between 2 groups were observed (C).

 

Messenger RNA Expression of P4HA, LO, and LH2b

Prolyl 4-hydroxylase α (P4HA) is a key enzyme regulating collagen biosynthesis, whereas lysyl oxidase (LO) and lysyl hydroxylase 2b (LH2b) are important for collagen cross-linking. The real-time PCR results showed that mRNA expression of P4HA in ST muscle was increased when lambs were fed the restricted diet (P < 0.01), whereas no differences were observed for both LO and LH2b mRNA expression (Fig. 4).

Figure 4.
Figure 4.

Messenger RNA expression of lysyl oxidase (LO), lysyl hydroxylase 2b (LH2b), and prolyl 4-hydroxylase α (P4HA) in semitendinosus muscle of ad libitum (□) and feed restriction (■) ram lambs. Data showed that mRNA content of P4HA was increased by feed restriction, whereas no changes were observed for LO and LH2b mRNA expression. **P < 0.01. (Mean ± SEM; n = 6 in each group.)

 

Messenger RNA Expression of MMP2 and Tissue Inhibitor of Metalloproteinases

Matrix metalloproteinases (MMP) are key regulators that catalyze collagen degradation and connective tissue remodeling. The mRNA expression of MMP1, MMP2, MMP9, and MMP13 did not change with dietary energy restriction in ST muscle (Fig. 5A). Matrix metalloproteinases’ activity is suppressed by tissue inhibitor of metalloproteinases (TIMP). Real-time PCR data indicated that mRNA contents of TIMP1 and TIMP2 were increased in feed-restricted lambs (P < 0.05), whereas there was no difference for TIMP3 mRNA expression (Fig. 5B).

Figure 5.
Figure 5.

mRNA expression of matrix metalloproteinases (MMP) and inhibitor of metalloproteinases (TIMP) in semitendinosus muscle of ad libitum (□) and feed restriction (■) ram lambs. Data showed that mRNA expression of MMP1, MMP2, MMP9, and MMP13 did not change (A). Messenger RNA expression of both TIMP2 and TIMP2 were increased, whereas no difference for the TIMP3 was observed (B). *P < 0.05. (Mean ± SEM; n = 6 in each group.)

 

Transforming Growth Factor β Signaling Pathway and p38 Phosphorylation

The transforming growth factor β (TGF-β) signaling pathway and its downstream mediator Smad2/3 are important for the induction of fibrogenesis. Western blotting results indicated that feed restriction did not alter TGF-β, Smad2/3, and phosphor-Smad2/3 protein contents in ST muscle (Fig. 6A, 6B, and 6C). p38 mitogen-activated protein kinase (MAPK) is another mediator involved in fibrogenesis. Although no difference in total p38 protein content was observed, phosphor-p38 protein content was reduced by the feed restriction (Fig. 6D and 6E).

Figure 6.
Figure 6.

The transforming growth factor β (TGF-β) signaling pathway, p38, and phosphros-p38 in semitendinosus muscle of ad libitum (□) and feed restriction (■) ram lambs. Western blotting data showed that there was no difference in TGF-β, Smad2/3, and phosphros-Smad2/3 protein contents (A, B, and C). An increased p38 phosphorylation was observed in feed restricted lambs (D and E). β-Actin was used as internal control; *P < 0.05. (Mean ± SEM; n = 6 in each group.)

 


DISCUSSION

Lamb consumption has increased considerably in recent years in several parts of the world (Morris, 2009). In the north of China, lamb production depends mainly on grazing on natural pastures. In this area, drought is a recurring meteorological phenomenon, which may limit forage production. Whether lamb tenderness is affected by the reduced nutrition supply remains undefined. In the present study, final BW, net gain, ADG, DMI, and carcass and meat weight were all decreased with decline of feed intake, suggesting that our model is well established. The diet of the current study was formulated according to the NRC’s recommendation (NRC, 2007); however, ADG in both the ad libitum group and the 65% dietary restricted group were lower than expected (300 g/d in ad libitum lambs), suggesting that the energy requirement of Dorper × small thin-tailed crossed rams is greater than the recommendation of the NRC. Actually, energy requirement and nutrient utilization are affected by cross-breeding (Fernandes et al., 2007).

Meat tenderness is usually evaluated instrumentally using the Warner-Bratzler shear method (Schönfeldt and Strydom, 2011). In the present study, a significantly reduced WBSF in ST muscle was observed in feed restriction lambs, which agrees with Abouheif et al. (1995), who reported that lambs fed a low-energy diet had greater WBSF (Abouheif et al., 1995). Previous studies demonstrate that shear force value depends on many factors, including handling before and at slaughter, sarcomere length, IMF content, age, breed, type and pH of muscle, and cooking manipulation (Shorthose et al., 1986; Abdullah and Qudsieh, 2009). The connective tissue is a dynamic network of molecules secreted by fibroblasts. Apart from serving as an integral component of cellular communication to influence cellular behavior (Hausman, 2012; Velleman, 2012), connective tissues and their cross-linking contribute to the background toughness of meat (Purslow, 2005). In skeletal muscle, type I, III, IV, V, VI, VII, XI, XII, XIV, XV, and X collagens have been identified (Gillies and Lieber, 2011). Collagen content within intramuscular connective tissue has been positively correlated with meat tenderness (Purslow, 2014). To determine whether collagen content was altered by feed restriction, we did Masson trichrome stain and hydroxyproline assay. Increased collagen content was observed when animals were fed a restricted diet, which is in accordance with previous reports that beef cattle fed with a low-energy diet had a significantly greater percentage of collagen (Dikeman et al., 1986; Archile-Contreras et al., 2010). Therefore, it is likely that altered collagen deposition by feed restriction may lead to increased WBSF in ST muscle of lamb.

Collagen content in skeletal muscle is determined by the balance between collagen degradation and synthesis. In skeletal muscle, the most abundant collagen types are collagen I and collagen III (Light et al., 1985). Collagen type I forms thick fibers whereas type III forms thin fibers (Junqueira et al., 1982). In the present study, mRNA expression of collagen I was increased in ST muscle of feed restriction lambs, whereas collagen III mRNA content was not altered, indicating that increased collagen content in ST muscle may enhanced synthesis of collagen I. To determine whether collagen degradation was changed by feed restriction, enzymes involved in collagen remodeling were analyzed. Matrix metalloproteinases, excreted from connective tissue and pro-inflammatory cells, are a large family of calcium-dependent endopeptidases. It is well established that MMP are essential for tissue remodeling and (ECM) degradation, including collagen, elastin, gelatin, matrix glycoprotein, and proteoglycan (Verma and Hansch, 2007). Tissue inhibitor of metalloproteinases are naturally occurring proteins that specifically inhibit MMP activity; balance between MMP and TIMP is crucial for appropriate assembly of ECM and numerous physiological processes (Gupta et al., 2014). In the present study, mRNA expression of MMP1, MMP2, MMP9, and MMP13 were not altered by feed restriction. Interestingly, we observed both TIMP1 and TIMP2 mRNA expression were elevated in feed restriction lambs. Therefore, it would be expected that activities of MMP in feed restriction lambs are inhibited, which further affects collagen degradation and remodeling.

To further explore the mechanisms of enhanced collagen deposition in ST muscle, we determined the muscle fiber area and size distribution. Feed restriction led to reduced muscle fiber area, which is in accordance with a previous study in pig (Bee et al., 2007). Due to change of muscle fiber size, distribution can affect intramuscular collagen deposition, and the reduced muscle fiber size by feed restriction may make extracellular matrix and connective tissue more concentrated. Previous study demonstrates that IMF accumulation can induce intramuscular connective tissue remodeling and bring about a weakening of the intramuscular connective tissue, which further contributes to tenderization of beef (Nishimura et al., 1999). In the present study, the IMF content in ST muscle was not influenced by feed restriction, suggesting that enhanced collagen content is not from IMF.

Collagen cross-link, a major post-translational modification of collagen, plays important roles in collagen fibrils stability. Collagen cross-link depends on a highly regulated mechanism, which is attributed to the presence of LH2b and LO (Saito and Marumo, 2010). LH2b catalyzes the hydroxylation of selected lysyl residue to increase pyridinoline cross-links, making collagen less susceptible to enzymatic degradation (Remst et al., 2014). LO is a copper-dependent amine oxidase, which deaminates selected lysyl and hydoxylysyl residues by oxidation and thereby initiates the formation of covalent cross-link and stabilizes collagen fibrils (Kagan and Li, 2003). The expression of both LH2b and LO did not show a difference between the 2 groups of animals. According to previous research, collagen cross-link depends on the growth rate (Aberle et al., 1981); therefore, it would be expected that a lower growth rate from feed restriction can increase the cross-link in ST muscle; even LH2b and LO mRNA expression did not change.

Conversion of prolyl residues to 4-hydroxyproline by the hydroxylation of proline in X-Pro-Gly sequences is another post-translational modification in collagen, and this reaction is catalyzed by P4H (Kivirikko et al., 1989). There are 4 subunits in P4H, and the α subunit is a catalytic subunit. In our study, the mRNA level of P4HA was increased in feed restriction conditions, which further proves the increased collagen deposition in ST muscle.

Fibrosis is regulated by a number of cytokines and growth factors, among which TGF-β has been recognized as the most powerful and widely expressed profibrogenic cytokine (Meng et al., 2015). TGF-β transduces the signals through type I and type II serine-threonine kinase receptors in cell surface. Once activated, the TGF-β receptor induces the activation of the SMAD signaling pathway and regulates a series of gene expressions that are involved in collagen synthesis and extracellular matrix deposition (Ikushima and Miyazono, 2012). To explore whether the TGF-β and downstream signaling mediators are changed, we did western blotting. Feed restriction did not affect TGF-β, Smad2/3, and phosphor-Smad2/3 at Ser423/425 contents, indicating that alteration of collagen I and fibronectin may not be from TGF-β signaling pathway. The p38 MAPK pathway transduces external stress stimuli and is important for EMC synthesis (Stambe et al., 2004). p38 can phosphorylate and activate Smad3, which further regulates fibrogenic genes (Kamaraju and Roberts, 2005). Interestingly, enhanced phosphor-p38 was observed in dietary restricted lambs, indicating that the p38 MAPK signaling pathway is activated. Previous study demonstrates that starvation can activate the p38 MAPK signaling pathway (Zheng et al., 2011); therefore, activation of the p38 signaling pathway in the current study should be responsible for the increased collagen content in ST muscle of feed restriction lambs.

Conclusions

The results obtained from the present study suggest that feed restriction in lambs increases WBSF and collagen content in ST muscle, which may be mediated through the p38 signaling pathway. These findings may be important for considering strategies for the manipulation of lambs to produce more tender meat.

 

References

Footnotes


Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.