View Full Table | Close Full ViewTable 1.

Ingredient and chemical composition of the mixed diet

 
Dietary ingredient Percent
Corn stalk 34.0
Sunflower seed null 11.0
Corn grain 27.3
Soybean meal 9.0
Rapeseed dregs 5.2
Distiller’s dried grain with solubles 6.1
Wheat bran 5.0
Salt 0.6
Mineral/vitamin premix 1.8
Total 100
Chemical composition (determined)
    DM, % as fed 91.88
    GE, MJ/kg of DM 17.29
    CP, % of DM 7.8
    NDF, % of DM 41.3
    Ash, % DM 5.81
    Ca, % of DM 0.54
    P, % of DM 0.38



View Full Table | Close Full ViewTable 2.

Primer sequences for real-time PCR

 
Name Sequence (5′–3′) Length, bp
Collagen I GACATCCCACCAGTCACCTG
GGGACTTTGGCGTTAGGACA
161
Collagen III AGGGCAGGGAACAACTGATG
ACAGTGGGATGAAGCAGAGC
145
Fibronectin ACCCTGGGTATGACACTGGA
CATTCGGCGGATACGGTCTT
165
MMP1 CAGAGAAACGGTGGCCTCAT
CAGTCACTCTCAGCCCGAAG
70
MMP2 AACGGCAAGGAGTACACCAG
AGAAGCCATACTTGCCGTCC
103
MMP9 TAGATCACTCCTCCGTGCCA
GGGCGAGGACCATACAGATG
115
TIMP1 TGCTGCTGGTTGTGAGGAAT
CCACAAGCAATGAGTGTCGC
82
TIMP2 TGGACTCTGGCAACGACATC
TCCTGGTCAGGTCCCTTGAA
91
TIMP3 TACCCTGGCTACCAGTCCAA
CAGGGGTCTGTGGCATTGAT
116
LO CCCAGCTATTTGGTGCCTGA
GTGAAATTGTGCAGCCCGAG
103
LH2b GTCTGCTCTGAGCCTTAAAACAC
TGTCACTTGTACATCTGTACCTGAA
152
P4Hb ACAGAAAGATGAGCCAGATGCT
CAGCAGTTCCCTTTTTGGGC
149
RPL 13 GCAAAAAGGGCCAAGGAAGC
CAAAGGTCAGACACACCCCA
155



View Full Table | Close Full ViewTable 3.

Effect of different dietary energy levels on growth and slaughter performance of Dorper × small thin-tailed lamb

 
Level of intake1
Item AL 65% SEM P-value
No. of lambs 6 6
Initial BW, kg 19.23 18.97 0.45 0.5817
Final BW, kg 35.12 28.42 0.27 <0.0001
Net gain, kg 15.89 9.45 0.48 <0.0001
ADG, g 248.30 147.70 7.52 <0.0001
DM intake, g/d 1,292.00 862.56 30.30 <0.0001
Feed:gain, g/g 5.21 5.84 0.28 0.0459
Carcass, kg 16.61 12.71 0.42 <0.0001
Meat weight, kg 10.55 8.21 0.44 0.0002
1AL = ad libitum; 65% = 65% of ad libitum feed intake.