Search
Author
Title
Vol.
Issue
Year
1st Page

Journal of Animal Science - Animal Nutrition

Does heat stress alter the pig’s response to dietary fat?1

 

This article in JAS

  1. Vol. 94 No. 11, p. 4688-4703
     
    Received: June 26, 2016
    Accepted: Sept 07, 2016
    Published: October 27, 2016


    2 Corresponding author(s): jfp@iastate.edu
 View
 Download
 Share

doi:10.2527/jas.2016-0756
  1. T. A. Kellner*,
  2. L. H. Baumgard*,
  3. K. J. Prusa,
  4. N. K. Gabler* and
  5. J. F. Patience 2*3
  1. * Department of Animal Science, Iowa State University, Ames 50011
     Department of Food Science and Human Nutrition, Iowa State University, Ames 50011

Abstract

Heat stress (HS) results in major losses to the pork industry via reduced growth performance and, possibly, carcass fat quality. The experimental objective was to measure the effects of HS on the pig’s response to dietary fat in terms of lipid digestion, metabolism, and deposition over a 35-d finishing period. A total of 96 PIC 337 × C22/C29 (PIC, Inc., Hendersonville, TN) barrows (initial BW of 100.4 ± 1.2 kg) were randomly allotted to 1 of 9 treatments arranged as a 3 × 3 factorial: thermoneutral (TN; constant 24°C; ad libitum access to feed), pair-fed thermoneutral (PFTN; constant 24°C; limit fed based on previous HS daily feed intake), or HS (cyclical 28°C nighttime, 33°C from d 0 to 7, 33.5°C from d 7 to 14, 34°C from d 14 to 21, 34.5°C from d 21 to 28, and 35°C from d 28 to 35 daytime; ab libitum access to feed) and diet (a corn–soybean meal–based diet with 0% added fat [CNTR], CNTR with 3% added tallow [TAL; iodine value {IV} = 41.8], or CNTR with 3% added corn oil [CO; IV = 123.0]). No interactions between environment and diet were evident for any major response criteria (P ≥ 0.063). Rectal temperature increased due to HS (39.0°C for HS, 38.1°C for TN, and 38.2°C for PFTN; P < 0.001). Heat stress decreased ADFI (27.8%; P < 0.001), ADG (0.72 kg/d for HS, 1.03 kg/d for TN, and 0.78 kg/d for PFTN; P < 0.001), and G:F (0.290 for HS, 0.301 for TN, and 0.319 for PFTN; P = 0.006). Heat stress barrows required 1.2 Mcal of ME intake more per kilogram of BW gain than PFTN (P < 0.001). Heat stress tended to result in the lowest apparent total tract digestibility of acid hydrolyzed ether extract (AEE; 59.0% for HS, 60.2% for TN, and 61.4% for PFTN; P = 0.055). True total tract digestibility (TTTD) of AEE of CO-based diets (99.3%) was greater than that of CNTR (97.3%) and TAL-based diets (96.3%; P = 0.012). Environment had no impact on TTTD of AEE (P = 0.118). Environment had no impact on jowl IV at market (69.2 g/100 g for HS, 69.3 g/100 g for TN, and 69.8 g/100 g for PFTN; P = 0.624). Jowl IV at market increased with increasing degree of unsaturation of the dietary fat (68.5 g/100 g for CNTR, 68.2 g/100 g for TAL, and 71.5 g/100 g for CO; P < 0.001). Heat stress decreased mRNA abundance of ATGL and HSL (P ≤ 0.041). Heat stress and CO increased mRNA abundance of SCD (P ≤ 0.047), and CO increased abundance of FASN (P = 0.011). In conclusion, HS does not alter the pig’s response to dietary fat. However, HS leads to reduced ADG, ADFI, G:F, and caloric efficiency and a suppression of mRNA abundance of genes involved in the lipolytic cascade, which resulted in a phenotype that was fatter than PFTN.



INTRODUCTION

Heat stress (HS) affects a plethora of swine production variables (Baumgard et al., 2012); its negative impact on ADG has been known for over 110 yr (Heitman et al., 1958). Despite improvements in barn design, genetics, management, and nutrition, HS remains one of the most costly issues for U.S. pork producers (St-Pierre et al., 2003; Renaudeau et al., 2012).

To reduce the negative impact of HS on energy intake (Hao et al., 2014; Pearce et al., 2014), producers formulate diets using ingredients that are energy dense and low in heat increment (Forbes and Swift, 1944; Stahly et al., 1981). Because dietary fat and oils are energy dense and have a low heat increment, (NRC, 2012; Kerr et al., 2015), their use increases in the hotter months of the year. Adding dietary fat has been shown to reduce the negative effects of HS on ADG (Stahly et al., 1981; Spencer et al., 2005). What is unknown is whether high ambient temperature affects the pig’s utilization of fat and if a fat source that is more unsaturated will be more effective at alleviating the negative effects of HS.

A review by Baumgard and Rhoads (2013) concluded that pigs that experience HS deposit more lipid than predicted based on their energy consumption. It is also known that the composition of dietary fat will be highly reflective of pork fat composition (Ellis and Isbell, 1926; Kellner et al., 2014). This creates a scenario where high fat diets are used to alleviate HS and HS pigs deposit even greater amounts of fat than expected, increasing the risk of carcass fat quality issues when HS occurs (Spencer et al., 2005; White et al., 2008).

The experimental objective was to determine if HS would impact the pig’s response to a more saturated or a less saturated dietary fat source in terms of growth performance, caloric efficiency, lipid metabolism, carcass quality, and carcass iodine value (IV).


MATERIALS AND METHODS

All experimental procedures adhered to guidelines for the ethical and humane use of animals for research, and were approved by the Iowa State University Institutional Animal Care and Use Committee (number 1-14-7703-S).

Animals, Housing, and Experimental Design

A total of 96 PIC 337 × C22/C29 (PIC, Inc., Hendersonville, TN) barrows, with an average initial BW of 100.4 ± 1.2 kg, were allotted by BW and pre-experiment ADG to 1 of 9 treatments arranged as a 3 × 3 factorial. The first factor was environmental treatment: thermoneutral (TN; ad libitum access to feed), pair-fed thermoneutral (PFTN; limit fed based on HS feed intake on the previous day), or HS (ab libitum access to feed). The second factor was diet: a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL; IV = 41.8), or CNTR with 3% added corn oil (CO; IV = 123.0). There were 2 sequential replications of 48 barrows each.

Pigs were housed in 2 identical rooms where temperature was controlled (Fig. 1), but humidity, although similar between the 2 rooms, was not regulated (Fig. 2). Each room contained 24 individual pens. Each pen provided 1.25 m2 of floor space, a nipple drinker, and a stainless steel feeder and had mesh metal flooring. Pigs were given ad libitum access to water throughout the experiment.

Figure 1.
Figure 1.

Ambient room temperature (°C) by day during the 35-d experiment. Temperature was controlled to achieve a constant 24°C in the thermoneutral room that housed thermoneutral and pair-fed thermoneutral barrows. The heat stress room that housed the heat stress barrows was controlled to heat in a diurnal pattern at 28°C from 2000 to 0800 h and at 33°C d from 0 to 7, 33.5°C from d 7 to 14, 34°C from d 14 to 21, 34.5°C from d 21 to 28, and 35°C from d 28 to 35 from 0800 to 2000 h.

 
Figure 2.
Figure 2.

Relative humidity (%) of the room by day during the 35-d experiment. Humidity was not governed during the 35-d experiment. Thermoneutral room housed thermoneutral and pair-fed thermoneutral barrows, and the heat stress room housed heat stress barrows.

 

The control room housed TN and PFTN barrows and was maintained within the TN temperature zone for pigs of this age (24°C; Comberg et al., 1972; Renaudeau et al., 2012). The HS room housed HS barrows and was heated in a diurnal pattern (Fig. 1) at 28°C from 2000 to 0800 h and at 33°C from d 0 to 7, 33.5°C from d 7 to 14, 34°C from d 14 to 21, 34.5°C from d 21 to 28, and 35°C from d 28 to 35 from 0800 to 2000 h. The temperature of the HS room was set greater than estimated upper critical temperature point from 0800 to 2000 h and set slightly less than the estimated upper critical temperature point from 2000 to 0800 h based on multiple studies complied by Renaudeau et al. (2012). Additionally, the upper temperature of the HS room was increased 0.5°C every 7 d to minimize acclimation to the environmental conditions during the 35-d experiment. Temperature and humidity in both rooms were recorded every 30 min using a data logger (Lascar EL-USB-2-LCD; Lascar Electronics, Erie, PA).

Diets and Feeding

All experimental diets (Table 1) were formulated on a constant ME to standardized ileal digestible lysine ratio and met or exceeded all nutrient requirements for pigs of this size (NRC, 2012). Diets contained 0.40% titanium dioxide as an indigestible marker to determine the apparent total tract digestibility (ATTD) of acid hydrolyzed ether extract (AEE), DM, and GE. All experimental diets were offered to the pigs in mash form. Dietary fat sources were selected to provide a diverse range of unsaturation while keeping in mind choices relevant to current production practices. Representative feed samples were collected at the time of mixing and stored at −20°C for later analysis. Prior to the initiation of the study, the pigs were fed a common diet similar to the experimental CNTR diet.


View Full Table | Close Full ViewTable 1.

Ingredient composition (as-fed basis) of the experimental diets formulated with no added fat (control), 3% corn oil, or 3% tallow

 
Ingredient, % Control 3% Corn oil 3% Tallow
Corn 84.36 79.74 79.74
Soybean meal (46.5% CP) 12.71 14.35 14.35
Corn oil 3.00
Tallow 3.00
Limestone 0.90 0.90 0.90
Monocalcium phosphate 0.56 0.53 0.53
Salt 0.50 0.50 0.50
l-Lysine HCL 0.15 0.15 0.15
dl-Methionine 0.01 0.01
l-Threonine 0.01 0.01 0.01
Vitamin premix1 0.20 0.20 0.20
Trace mineral premix2 0.15 0.15 0.15
Titanium dioxide 0.40 0.40 0.40
Santoquin3 0.06 0.06 0.06
Formulated composition
    Standard ileal digestible AA, %
        Lysine 0.61 0.64 0.64
        Methionine 0.20 0.21 0.21
        Methionine + cysteine 0.41 0.42 0.42
        Threonine 0.39 0.41 0.41
        Tryptophan 0.12 0.12 0.12
Calculated composition
    NE, Mcal/kg 2.54 2.67 2.67
    Heat increment,4 Mcal/kg 1.16 1.34 1.18
    ME,5 Mcal/kg 3.70 3.90 3.85
Analyzed composition
    DM, % 88.65 89.01 88.39
    GE, Mcal/kg 3.81 4.01 3.95
    CP (N × 6.25), % 13.16 13.56 13.55
    Crude fat, % 3.18 6.21 6.22
    Dietary fat IV,6 g/100g 123.0 41.8
    Diet IV,7 g/100g 117.9 120.8 84.6
    Diet IVP8 37.5 75.0 52.6
1Provided 6,614 IU vitamin A, 827 IU vitamin D, 26 IU vitamin E, 2.6 mg vitamin K, 29.8 mg niacin, 16.5 mg pantothenic acid, 5.0 mg riboflavin, and 0.023 mg vitamin B12 per kilogram of diet.
2Provided 165 mg Zn (zinc sulfate), 165 mg Fe (iron sulfate), 39 mg Mn (manganese sulfate), 17 mg Cu (copper sulfate), 0.3 mg I (calcium iodate), and 0.3 mg Se (sodium selenite) per kilogram of diet.
3Santoquin Mixture 6 (feed and forage antioxidant; Novus International, St. Charles, MO).
4Heat increment = ME NE
5ME = DE × [1.003 (0.0021 × CP)] (Noblet and Perez, 1993).
6Iodine value (IV) determined via titration (Barrow-Agee Laboratories, LLC, Memphis, TN).
7Iodine value calculated from fatty acid composition: IV = [C16:1] × 0.95 + [C18:1] × 0.86 + [C18:2] × 1.732 + [C18:3] × 2.616 + [C20:1] × 0.785 + [C22:1] × 0.723; brackets indicate concentration (AOCS, 1998).
8Iodine value product (IVP) = (IV of the dietary lipids) × (% dietary lipid) × 0.10 (Christensen, 1962; Madsen et al., 1992).

Sample Collection

Pigs were individually weighed on d 0, 7, 14, 21, and 35. Feeders in the TN pens were weighed on d 0, 7, 14, 21, and 35. Feeders in the HS room were weighed daily to determine daily feed intake for the next day’s PFTN feed allotment. If any feed remained in the feeders of PFTN barrows at 0800 h, it was measured and discarded before the next daily allotment of feed was added. These measurements allowed for the determination of ADG, ADFI, and G:F. Fecal grab samples were collected fresh from each pig on d 16 to 18 and immediately stored at −20°C for later analysis.

Rectal temperature was measured daily with a dual-scale digital thermometer at 1100 h (VetOne; MWI Veterinary Supply, Boise, ID). Daily respiration rate was determined by counting flank movements at 1200 h. Both measurements were taken in duplicate and condensed into daily averages if numerical differences occurred.

Subcutaneous fat samples from the jowl were collected on d 7 and 21 by biopsy, using local anesthesia. The skin was removed from each 10 g lipid sample. Once the skin was removed, an approximately 200 mg cross-section was taken and placed into a 2.5 mL ribonuclease-free microcentrifuge tube (FisherBrand; Fisher Science, Hanover Park, IL) with 2 mL of TRIzol reagent (Invitrogen, Carlsbad, CA). The remaining lipid sample was inserted into a 7.62 by 12.70 cm plastic bag (FisherBrand; Fisher Science) and snap-frozen using liquid nitrogen. These samples were immediately placed on dry ice and then stored at −80°C for later analysis.

On d 35, pigs were marketed at the JBS Swift & Co. processing plant in Marshalltown, IA, where HCW, loin depth, and back fat thickness were measured. Following carcass chilling, a 100-g sample of fat from the right jowl of each carcass was collected, vacuum-packaged, and stored at −20°C until analyzed. The loin from the right side of each carcass was measured for pH using a Hanna HI925 m with an FC200 hard glass electrode (Hanna Instruments, Woonsocket, RI), for loin color score (Japanese color bar 1 to 6, with 1 = extremely light and 6 = extremely dark; Sullivan et al., 2007), and for loin marbling score according to national pork board standards (NPPC, 2000). The right side of the belly from each carcass was collected and measured for weight, temperature, and thickness. Belly thickness was measured in 2 locations in the center of the belly for middle thickness and at the center of the scribe edge of the belly for edge thickness. A belly firmness test was conducted using a durometer (model 1600-OOO-S; Electromatic Equipment Co., Inc., Cedarhurst, NY), which measured compression of the belly (1 to 100, with 1 = least firm and 100 = firmest; Semen et al., 2013; Kellner et al., 2015). A subjective belly firmness test was conducted by assigning a visual score (1 to 3, in which 1 = firmest and 3 = least firm) based on the degree of flop of the belly (Kellner et al., 2014). Objective color measures were obtained using a Minolta Chromameter CR 310 (Minolta Corp., Ramsey, NJ) equipped with a 50-mm orifice calibrated against a white tile. Objective color and durometer measures were taken in the middle of the belly with skin removed 3 cm from the proximal edge. The temperature of each belly analyzed was recorded with a thermometer (model 7937; Fisher Science). No treatment differences among belly temperatures were evident (2.5 ± 0.7°C; P = 0.580).

Analytical Methods

Fatty acids were extracted from adipose tissue and feed samples by a 1-step direct transesterification procedure (Lepage and Roy, 1986). The fatty acid profile was then determined by gas chromatography using a model 3900 gas chromatograph fitted with a CP 8400 automatic injector (Varian Inc., Walnut Creek, CA) and a 60-m capillary column (0.25 mm diameter; model DB-23; Agilent Technologies, Santa Clara, CA). Helium was used as a carrier gas at 0.5 mL/mm (1:50 split ratio). Oven temperature started at 50°C and increased to 235°C over a 26-min period. The injector and detector were maintained at 250°C. Identification of fatty acid peaks was performed by comparison with purified fatty acid samples obtained from Sigma-Aldrich, Co. (St. Louis, MO).

Prior to analysis, fecal and feed samples were homogenized and then finely ground through a 1-mm screen in a Retsch grinder (model ZM1; Retsch Inc., Newtown, PA). Acid hydrolyzed ether extract (method 2003.06; AOAC, 2007) was analyzed using a SoxCap SC 247 hydrolyzer and a Soxtec 255 semiautomatic extractor (FOSS North America, Eden Prairie, MN). Dry matter was determined according to modified methods (930.15; AOAC, 2007) by drying samples in an oven at 105°C to a constant weight. Gross energy was determined using a bomb calorimeter (model 6200; Parr Instrument Co., Moline, IL). Benzoic acid (6.318 Mcal/kg; Parr Instrument Co.) was used as the standard for calibration (6.320 ± 0.006 Mcal/kg determined GE). Titanium dioxide was determined by spectrophotometer (synergy 4; BioTek Instruments Inc., Winooski, VT) according to the method of Leone (1973). All chemical analyses were performed in duplicate and repeated when the intraduplicate CV was greater than 1%.

Adipose tissue stored in TRIzol was homogenized using a Clean PowerGen 700D homogenizer (Fisher Science). Total RNA was then isolated from adipose tissue using TRIzol reagent following the manufacturer’s protocol with the modification of repeating the RNA pellet wash step 3 times to reduce 230 nm contamination. Isolated RNA was then used for cDNA synthesis using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). Abundance differences of mRNA were determined using quantitative PCR (BioRad iCycler; BioRad Laboratories, Hercules, CA) on 12 genes. Expression normalization across samples within tissue was performed by calculating a delta cycle threshold (Ct) value for each sample using RPL32, as transcript abundance proved to be similar among treatments (P < 0.05).

Calculations

According to the equation of Oresanya et al. (2007), ATTD, percent of AEE, DM, and GE were calculated as 100 − {100 × [concentration (g) of TiO2 in diet × concentration of (g) of AEE, DM, or GE in feces]/[concentration (g) of TiO2 in feces × concentration of AEE, DM, or GE in diet]}. True total tract digestibility (TTTD; %) of AEE was calculated by correcting ATTD of AEE for endogenous fat losses at 20 g of AEE/kg of DM intake (Acosta Camargo et al., 2015).

Delta delta Ct (ΔΔCt) values were calculated from delta Ct values using a reference sample. Fold differences among treatments were calculated using the following equation: 2|ΔΔCt(treatment A) − ΔΔCt(treatment B)|. The fold difference among treatments is expressed where a positive value indicates an increase in transcript abundance and a negative value indicates a decrease.

Iodine value was calculated from the fatty acid profile using the following equation: IV = (C16:1 × 0.95) + (C18:1 × 0.86) + (C18:2 × 1.732) + (C18:3 × 2.616) + (C20:1 × 0.785) + (C22:1 × 0.723) (AOCS, 1998).

Statistical Analysis

Analysis of the 9 treatments arranged as a 3 × 3 factorial and the main effects of environment (TN vs. PTFN vs. HS) and dietary fat (CNTR vs. CO vs. TAL) and their interactions (environment × dietary fat interaction [E×DF]) were analyzed using PROC MIXED (SAS 9.4; SAS Inst. Inc., Cary, NC) with replicate as a random effect. Pig was the experimental unit. For each variable, normal distribution of residuals was tested using PROC UNIVARIATE.

Nondetectable fatty acid values were treated in all statistical analyses as 0. All P-values less than 0.05 were considered significant and P-values between 0.05 and 0.10 were considered trends.


RESULTS

Environment and Dietary Fat Effects on Rectal Temperature and Respiration Rate

As expected, during the 35-d experimental period, HS pigs had an increased rectal temperature and greater than twice the respiration rate of TN and PFTN pigs (P < 0.001; Table 2). Dietary fat had no impact on either rectal temperature or respiration rate (P ≥ 0.203). There was no E×DF evident for rectal temperature or respiration rate, which indicates that HS pigs sustained a heat load indicative of marked HS and that dietary fat did not increase or decrease the degree of HS (P ≥ 0.192).


View Full Table | Close Full ViewTable 2.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on daily respiration rate (RR), rectal temperature (RT), growth performance, and feed efficiency from d 0 to 35

 
Environment
Dietary fat
E×DF4
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
Initial BW, kg5 101.5 99.9 100.5 0.9 0.406 100.6 101.2 100.0 0.9 0.644 0.903
Final BW, kg6 137.0 127.2 125.0 1.3 <0.001 129.5 131.1 128.6 1.3 0.366 0.867
RR, breaths/min 36.3b 34.2b 78.3a 1.6 <0.001 50.2 49.0 49.6 1.7 0.692 0.904
RT, °C 38.1b 38.2b 39.0a 0.1 <0.001 38.4 38.4 38.5 0.1 0.653 0.192
ADG, kg 1.03a 0.77b 0.72b 0.03 <0.001 0.83 0.87 0.83 0.03 0.492 0.413
ADFI, kg 3.46a 2.49b 2.49b 0.10 <0.001 2.89 2.82 2.72 0.10 0.124 0.978
G:F 0.301ab 0.319a 0.290b 0.013 0.006 0.292 0.314 0.303 0.013 0.073 0.500
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Probability value for environment × dietary fat interaction (E×DF).
5d 0.
6d 35.

Environment and Dietary Fat Effects on Growth Performance, Feed Intake, and Feed Efficiency

There were no E×DF for ADG, ADFI, or G:F (P ≥ 0.157; Table 2). As expected, the ADG of TN pigs was greater than that of PFTN and HS pigs (P < 0.001). Dietary fat had no impact on ADG (P ≥ 0.413; Table 2). As expected, the ADFI of TN pigs was greater than that of HS pigs and, by design, the ADFI of HS and PFTN pigs were not different (P < 0.001; Table 2). Overall, PFTN barrows converted gain from feed with greater efficiency than HS barrows (P < 0.001; Table 2). Overall, a CO-based diet tended to increase G:F, with TAL as the intermediate and CNTR as the least efficient (P = 0.073; Table 2). Part of the difference between the fat sources could be due to slight differences in their available energy content.

Environment and Dietary Fat Effects on Energy Intake and Caloric Efficiency

No E×DF were evident for energy intake or caloric efficiency (P ≥ 0.477; Table 3). By design, ME intake of HS and PFTN pigs were similar and both were less than TN pigs (P < 0.001). Barrows in the HS environment required more megacalories of ME to deposit 1 kg of BW or 1 kg of carcass weight than barrows in the PFTN environment (P ≤ 0.021). There was a tendency for barrows fed a TAL-based diet to consume less energy per day (P = 0.090), but there was no impact of dietary fat on caloric efficiency (P ≥ 0.654).


View Full Table | Close Full ViewTable 3.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on energy intake and caloric efficiency

 
Environment
Dietary fat
E×DF4
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
ME intake, Mcal/d 13.1a 9.6b 9.5b 0.4 <0.001 10.7 11.0 10.4 0.4 0.090 0.990
ME intake:BW gain 12.8ab 12.2b 13.4a 0.7 0.013 12.8 12.6 13.0 0.7 0.654 0.477
ME intake:carcass gain 17.2ab 16.6b 18.1a 1.0 0.021 17.4 17.1 17.5 1.0 0.786 0.509
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment, P < 0.05.
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Probability value for environment × dietary fat interaction (E×DF).

Environment and Dietary Fat Effects on Digestibility of DM, Energy, and Lipids

No E×DF were evident for digestibility of DM, GE, or AEE (P ≥ 0.253; Table 4). No differences were evident among environment or dietary fat treatments for ATTD of DM (P ≤ 0.223). The ATTD of GE was decreased in TN pigs when compared with PFTN and HS pigs (P = 0.008). Barrows in the HS environment compared with barrows in the TN environment tended to have decreased ATTD of AEE (P = 0.055) but not TTTD of AEE (P = 0.118).


View Full Table | Close Full ViewTable 4.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on apparent total tract digestibility (ATTD)4 and true total tract digestibility (TTTD)5 of DM, GE, and acid hydrolyzed ether extract (AEE)

 
Environment
Dietary fat
E×DF6
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
ATTD, %
    DM 88.0 88.7 88.4 0.2 0.223 88.4 88.5 88.2 0.2 0.524 0.253
    GE 88.2b 89.1a 88.8a 0.2 0.008 88.4y 89.1x 88.6y 0.2 0.011 0.525
    AEE 60.2 61.4 59.0 0.8 0.055 41.5z 71.2x 67.8y 0.8 <0.001 0.886
TTTD, %
    AEE 97.9 98.5 96.7 0.7 0.118 97.3y 99.3x 96.3y 0.7 0.012 0.932
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment (P < 0.05).
x–zWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Apparent total tract digestibility (%) of either AEE, DM, or GE was calculated as 100 {100 × [concentration (g) of TiO2 in diet × concentration of (g) of AEE, DM, or GE in feces]/[concentration (g) of TiO2 in feces × concentration of AEE, DM, or GE in diet]}; (Oresanya et al. 2007).
5Calculated via correcting ATTD of AEE for endogenous fat losses at 20 g AEE/kg DM intake.
6Probability value for environment × dietary fat interaction (E×DF).

The ATTD of GE, ATTD of AEE, and TTTD of AEE was increased for a CO-based diet compared with the CNTR and TAL-based diets (P ≤ 0.012; Table 4). Barrows on the CNTR diet had decreased ATTD of AEE compared with barrows on a TAL-based diet, but the difference between the 2 diets was not evident for TTTD of AEE (P < 0.050).

Environment and Dietary Fat Effects on Belly, Carcass, and Loin Characteristics

No E×DF were evident for any belly, carcass, or loin characteristics (P ≥ 0.215; Table 5). The HCW and back fat was greater for TN carcasses than both PFTN and HS carcasses (P ≤ 0.011). Carcasses from PFTN pigs tended to yield less (P = 0.096) and have increased fat-free lean (P = 0.089). Loin depth was unaffected by environmental treatment (P = 0.261). The 3% CO diets resulted in decreased loin depth (P = 0.006), but HCW, yield, back fat depth, and fat-free lean were unaffected by dietary fat (P ≥ 0.129).


View Full Table | Close Full ViewTable 5.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on carcass characteristics

 
Environment
Dietary fat
E×DF4
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
HCW, kg 101.5a 93.1b 92.1b 1.2 <0.001 95.2 96.5 95.1 1.2 0.554 0.827
Yield, % 74.1 73.2 73.7 0.4 0.096 73.5 73.6 74.0 0.4 0.407 0.600
Loin depth, cm 6.23 5.95 5.97 0.23 0.261 6.11x 5.73y 6.30x 0.24 0.006 0.387
Back fat, cm 2.29a 1.99b 2.10b 0.21 0.011 2.19 2.14 2.06 0.21 0.353 0.854
Fat-free lean, % 52.4 53.9 53.2 1.5 0.089 52.9 52.7 52.9 1.6 0.129 0.774
Loin characteristics
    Ultimate pH 5.6 5.6 5.6 0.1 0.873 5.6 5.6 5.7 0.1 0.199 0.640
    LCS5 3.2 3.0 3.1 0.1 0.561 3.0 3.1 3.1 0.1 0.806 0.693
    LMS6 1.8 1.8 1.7 0.1 0.495 1.7 1.7 1.8 0.1 0.829 0.515
Belly characteristics
    Belly weight, kg 8.6a 7.5b 7.8b 0.2 <0.001 8.0xy 8.3x 7.7y 0.2 0.018 0.372
    Belly ET,7 cm 3.11 2.81 2.76 0.25 0.055 2.94 2.88 2.86 0.25 0.856 0.313
    Belly MT,8 cm 2.47a 2.23b 2.20b 0.08 0.029 2.28 2.36 2.25 0.08 0.568 0.919
    l* 71.8b 73.2a 73.4a 0.6 0.021 73.4 72.6 72.4 0.6 0.177 0.309
    a* 11.6a 9.9b 10.4b 0.4 0.003 10.3 10.7 10.9 0.4 0.452 0.318
    b 7.7 7.3 7.4 0.2 0.303 7.3 7.6 7.5 0.2 0.210 0.215
    Durometer 44.4 41.9 42.7 2.5 0.682 44.7 42.6 41.8 2.4 0.547 0.687
    Belly firmness9 2.2 2.4 2.4 0.1 0.243 2.3 2.5 2.2 0.1 0.220 0.720
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment (P < 0.05).
x,yWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Probability value for environment × dietary fat interaction (E×DF).
5LCS = loin color score; evaluated postmortem according to the Japanese color bar 1 to 6 scale: 1 = extremely light and 6 = extremely dark (Sullivan et al., 2007).
6LMS = loin marbling score; evaluated postmortem according to national pork board standards (NPPC, 2000). The marbling standards correspond to percentage of intramuscular lipid.
7ET = edge thickness; measured in the middle scribe side of the belly.
8MT = middle thickness; measured in the middle of the belly.
9Measured by a subjective flop test with a score of 1, 2, or 3, with 1 being the firmest.

Loin characteristics were unaffected by E×DF (P ≥ 0.495; Table 5). Bellies from TN barrows had increased weight, middle thickness, and a * values (P ≤ 0.029) and tended to have increased edge thickness (P = 0.055) compared with PFTN and HS bellies. Bellies from PFTN and HS barrows had increased l * values than TN bellies (P = 0.021). Environment did not affect b * values or belly firmness (P ≥ 0.243). Bellies from barrows fed a CO-based diet were heavier than bellies from those fed a TAL-based diet (P = 0.018). However, belly thickness, fat color, and belly firmness was unaffected by dietary fat (P ≥ 0.215).

Environment and Dietary Fat Effects on Fatty Acid Profile and Calculated Carcass Iodine Value

Oleic acid (C18:1) concentrations in jowl fat on d 7 collected from HS barrows tended to be less when the barrows were fed either a CO-based diet or a TAL-based diet but were greater in concentration when no additional fat was added in comparison with PFTN, resulting in a E×DF (P = 0.063; Table 6). The sum of other minor SFA increased in TN and HS pigs compared with PFTN pigs (P = 0.014). Additionally, myristic acid tended to be greater in concentration in TN and HS jowl fat than PFTN (P = 0.055). The sum of other minor unsaturated fatty acids tended to increase in concentration in TN jowl fat (P = 0.060). Three percent TAL increased the concentration of eicosatrienoic acid (P = 0.039), whereas 3% CO tended to increase the concentration of linoleic acid (C18:2; P = 0.093) in jowl fat collected on d 7. Environment or dietary fat did not alter the IV, the unsaturated to saturated fatty acid ratio (U:S), or the omega-3 to omega-6 (n-3:n-6) fatty acid ratio (P ≥ 0.167).


View Full Table | Close Full ViewTable 6.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on fatty acid profile and calculated iodine value (IV)4 of jowl fat on d 7

 
Environment
Dietary fat
E×DF5
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
Fatty acid,6 %
    C12:0, % 0.04 0.04 0.04 0.01 0.655 0.04 0.04 0.04 0.01 0.925 0.112
    C13:0, % 0.04 0.04 0.04 0.01 0.623 0.04 0.04 0.04 0.01 0.936 0.372
    C14:0, % 1.10 1.05 1.12 0.02 0.055 1.11 1.06 1.10 0.02 0.210 0.557
    C15:0, % 0.04 0.04 0.04 0.01 0.516 0.03 0.04 0.04 0.01 0.592 0.398
    C16:0, % 22.37 22.03 22.36 0.20 0.440 22.41 22.25 22.09 0.20 0.525 0.566
    C16:1, % 2.44 2.22 2.32 0.13 0.270 2.46 2.29 2.23 0.13 0.169 0.848
    C17:0, % 0.54 0.55 0.53 0.07 0.845 0.54 0.52 0.56 0.07 0.477 0.786
    17:1, % 0.36 0.36 0.37 0.04 0.882 0.37 0.35 0.38 0.04 0.323 0.372
    C18:0, % 10.83 11.23 11.20 0.34 0.461 10.98 11.13 11.15 0.34 0.861 0.475
    C18:1, % 44.36 44.61 43.66 0.35 0.101 44.50 43.63 44.50 0.35 0.140 0.063
    C18:2, % 14.80 14.86 15.23 0.36 0.527 14.51 15.55 14.84 0.36 0.093 0.752
    C18:3, % 0.63 0.64 0.67 0.03 0.117 0.64 0.66 0.65 0.03 0.556 0.957
    C20:0, % 0.12 0.09 0.14 0.03 0.250 0.08 0.13 0.14 0.03 0.124 0.291
    C20:1, % 0.93 0.92 0.90 0.06 0.468 0.93 0.89 0.93 0.06 0.305 0.495
    C20:2, % 0.78 0.79 0.76 0.03 0.659 0.77 0.80 0.77 0.03 0.669 0.444
    C20:3, % 0.11 0.09 0.09 0.01 0.369 0.07y 0.10xy 0.12x 0.01 0.039 0.760
    C22:1, % 0.30 0.30 0.30 0.02 0.958 0.29 0.30 0.29 0.02 0.814 0.450
    Other SFA, % 0.15a 0.11b 0.14a 0.02 0.014 0.13 0.13 0.13 0.02 0.939 0.186
    Other UFA,7 % 0.07 0.05 0.04 0.01 0.060 0.05 0.05 0.06 0.01 0.795 0.194
U:S8 1.84 1.85 1.81 0.03 0.544 1.83 1.83 1.84 0.03 0.956 0.311
IV, g/100g 68.7 68.8 68.8 0.50 0.976 68.4 69.3 68.7 0.05 0.425 0.929
n-3:n-6 fatty acid ratio9 0.049 0.048 0.049 0.003 0.563 0.048 0.048 0.050 0.003 0.167 0.757
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment (P < 0.05).
x,yWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Iodine value was calculated by [C16:1] × 0.95 + [C18:1] × 0.86 + [C18:2] × 1.732 + [C18:3] × 2.616 + [C20:1] × 0.785 + [C22:1] × 0.723; brackets indicate percentage concentration (AOCS, 1998).
5Probability value for environment × dietary fat interaction (E×DF).
6Lauric acid (C12:0), tridecanoic acid (C13:0), myristic acid (C14:0), pentadecanoic acid (C15:0), palmitic acid (C16:0), palmitoleic acid (C16:1), margaric acid (C17:0), heptadecenoic acid (C17:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), gadoleic acid (C20:1), eicosadienoic acid (C20:2), eicosatrienoic acid (C20:3), and docosenoic acid (C22:1).
7UFA = unsaturated fatty acids.
8U:S = unsaturated to saturated fatty acid ratio.
9Omega-3 fatty acid to omega-6 fatty acid ratio.

In jowl fat collected on d 21 and 35, no E×DF were evident for fatty acid concentrations, IV, the U:S, or the n-3:n-6 fatty acid ratio, and none of these parameters were impacted by environmental treatment (P ≤ 0.102; Tables 7 and 8). On d 21, C18:1 decreased (P = 0.022; Table 7) but C18:2 increased (P < 0.001) in barrows fed CO-based diets. These changes on d 21 caused jowl IV to increase and the n-3:n-6 fatty acid ratio to decrease (P < 0.001); the U:S (P = 0.063) tended to decrease in barrows fed CO. On d 35, the use of 3% dietary CO resulted in decreased C18:1 (P < 0.001; Table 8). Feeding a CO-based diet also increased linoleic, linolenic, and eicosadienoic acid concentrations in jowl fat on d 35 (P ≤ 0.003). These effects on d 35 caused jowl IV to increase and the n-3:n-6 fatty acid ratio to decrease (P < 0.001).


View Full Table | Close Full ViewTable 7.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on fatty acid profile and calculated iodine value (IV)4 of jowl fat on d 21

 
Environment
Dietary fa
t
E×DF5
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
Fatty acid,6 %
    C12:0, % 0.05 0.04 0.04 0.01 0.102 0.05 0.04 0.04 0.01 0.479 0.829
    C13:0, % 0.04 0.03 0.05 0.01 0.158 0.04 0.04 0.04 0.01 0.917 0.986
    C14:0, % 1.13 1.07 1.12 0.03 0.109 1.12 1.10 1.10 0.03 0.785 0.454
    C15:0, % 0.04 0.03 0.03 0.01 0.867 0.03 0.04 0.03 0.01 0.886 0.949
    C16:0, % 22.22 21.80 21.90 0.20 0.370 22.18 21.73 22.00 0.20 0.294 0.768
    C16:1, % 2.57 2.43 2.46 0.11 0.574 2.47 2.49 2.51 0.11 0.951 0.382
    C17:0, % 0.49 0.47 0.51 0.05 0.540 0.48 0.48 0.51 0.05 0.496 0.264
    C17:1, % 0.34 0.35 0.36 0.04 0.525 0.36 0.33 0.36 0.04 0.311 0.778
    C18:0, % 10.44 10.49 10.42 0.36 0.970 10.64 10.12 10.58 0.36 0.162 0.662
    C18:1, % 45.91 46.06 45.36 0.49 0.349 45.73xy 45.01y 46.60x 0.49 0.022 0.251
    C18:2, % 13.78 14.24 14.65 0.36 0.197 13.89y 15.57x 13.20y 0.36 <0.001 0.473
    C18:3, % 0.58 0.61 0.63 0.03 0.125 0.61 0.63 0.58 0.03 0.124 0.818
    C20:0, % 0.11 0.09 0.12 0.03 0.659 0.10 0.09 0.14 0.03 0.420 0.810
    C20:1, % 0.99 0.98 0.96 0.06 0.697 0.98 0.95 1.01 0.06 0.340 0.194
    C20:2, % 0.72 0.77 0.75 0.04 0.696 0.73 0.77 0.74 0.04 0.717 0.159
    C20:3, % 0.10 0.08 0.09 0.02 0.618 0.10 0.08 0.09 0.02 0.449 0.149
    C22:1, % 0.26 0.27 0.27 0.02 0.848 0.26 0.27 0.27 0.02 0.857 0.310
    Other SFA, % 0.12 0.11 0.13 0.01 0.238 0.13 0.12 0.12 0.01 0.537 0.508
    Other UFA,7 % 0.07 0.05 0.05 0.01 0.134 0.05 0.05 0.06 0.01 0.804 0.169
U:S8 1.90 1.94 1.92 0.04 0.659 1.88 1.97 1.90 0.04 0.063 0.812
IV, g/100g 68.3 69.2 69.3 0.7 0.259 68.3y 70.6x 67.8y 0.7 <0.001 0.960
n-3:n-6 fatty acid ratio9 0.048 0.048 0.048 0.004 0.860 0.050x 0.045y 0.049x 0.004 <0.001 0.146
x,yWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Iodine value was calculated by [C16:1] × 0.95 + [C18:1] × 0.86 + [C18:2] × 1.732 + [C18:3] × 2.616 + [C20:1] × 0.785 + [C22:1] × 0.723; brackets indicate percentage concentration (AOCS, 1998).
5Probability value for environment × dietary fat interaction (E×DF).
6Lauric acid (C12:0), tridecanoic acid (C13:0), myristic acid (C14:0), pentadecanoic acid (C15:0), palmitic acid (C16:0), palmitoleic acid (C16:1), margaric acid (C17:0), heptadecenoic acid (C17:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), gadoleic acid (C20:1), eicosadienoic acid (C20:2), eicosatrienoic acid (C20:3), and docosenoic acid (C22:1).
7UFA = unsaturated fatty acids.
8U:S = unsaturated to saturated fatty acid ratio.
9Omega-3 fatty acid to omega-6 fatty acid ratio.

View Full Table | Close Full ViewTable 8.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on fatty acid profile and calculated iodine value (IV)4 of jowl fat on d 35

 
Environment
Dietary fat
E×DF5
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
Fatty acid,6 %
    C12:0, % 0.04 0.04 0.04 0.01 0.315 0.04 0.04 0.04 0.01 0.913 0.710
    C14:0, % 1.11 1.04 1.08 0.03 0.257 1.08 1.07 1.08 0.03 0.902 0.955
    C15:0, % 0.04 0.04 0.03 0.01 0.294 0.03 0.04 0.04 0.01 0.054 0.168
    C16:0, % 21.88 21.36 21.72 0.19 0.211 21.72 21.47 21.78 0.19 0.508 0.580
    C16:1, % 2.39 2.24 2.36 0.08 0.338 2.41 2.26 2.31 0.08 0.327 0.477
    C17:0, % 0.38 0.41 0.40 0.04 0.427 0.38 0.39 0.42 0.04 0.089 0.129
    C17:1, % 0.36 0.38 0.36 0.03 0.492 0.36 0.36 0.38 0.03 0.302 0.162
    C18:0, % 10.51 10.43 10.70 0.41 0.529 10.53 10.29 10.82 0.41 0.162 0.138
    C18:1, % 45.88 46.59 45.99 0.45 0.497 47.14x 44.65y 46.67x 0.46 <0.001 0.178
    C18:2, % 14.40 14.41 14.30 0.37 0.961 13.73y 16.30x 13.44y 0.37 <0.001 0.116
    C18:3, % 0.62 0.64 0.64 0.02 0.707 0.60y 0.68x 0.61y 0.03 0.003 0.533
    C20:0, % 0.15 0.15 0.14 0.01 0.600 0.14 0.15 0.15 0.01 0.705 0.167
    C20:1, % 0.94 0.96 0.94 0.03 0.767 0.97 0.92 0.95 0.03 0.351 0.245
    C20:2, % 0.76 0.78 0.76 0.02 0.658 0.73y 0.84x 0.73y 0.02 <0.001 0.494
    C20:3, % 0.11 0.11 0.11 0.01 0.872 0.10 0.11 0.11 0.01 0.127 0.882
    C22:1, % 0.27 0.27 0.28 0.01 0.649 0.26 0.29 0.27 0.01 0.082 0.304
    Other SFA, % 0.11 0.11 0.11 0.01 0.839 0.11 0.11 0.11 0.01 0.965 0.269
    Other UFA,7 % 0.03 0.05 0.03 0.01 0.260 0.03 0.03 0.05 0.01 0.068 0.645
U:S8 1.93 1.98 1.93 0.05 0.370 1.95 1.99 1.91 0.05 0.164 0.185
IV, g/100g 69.3 69.8 69.2 0.7 0.624 68.5y 71.5x 68.2y 0.7 <0.001 0.197
n-3:n-6 fatty acid ratio9 0.050 0.051 0.051 0.003 0.216 0.051y 0.047z 0.053x 0.003 <0.001 0.115
x–zWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Iodine value was calculated by [C16:1] × 0.95 + [C18:1] × 0.86 + [C18:2] × 1.732 + [C18:3] × 2.616 + [C20:1] × 0.785 + [C22:1] × 0.723; brackets indicate percentage concentration (AOCS, 1998).
5Probability value for environment × dietary fat interaction (E×DF).
6Lauric acid (C12:0), tridecanoic acid (C13:0), myristic acid (C14:0), pentadecanoic acid (C15:0), palmitic acid (C16:0), palmitoleic acid (C16:1), margaric acid (C17:0), heptadecenoic acid (C17:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), gadoleic acid (C20:1), eicosadienoic acid (C20:2), eicosatrienoic acid (C20:3), and docosenoic acid (C22:1).
7UFA = unsaturated fatty acids.
8U:S = unsaturated to saturated fatty acid ratio.
9Omega-3 fatty acid to omega-6 fatty acid ratio.

Environment and Dietary Fat Effects on mRNA Abundance in Adipose Tissue

Interactions between environment × dietary fat were not evident for the mRNA abundance of ACLY, ACSS2, ACACA, FASN, SCD, FADS2, EVOLV6, PRKAG1, PLIN1, ATGL, HSL, and INSR in adipose tissue collected on d 7 (P ≥ 0.150; Table 9). After 7 d of environmental treatment, the mRNA abundance of ATGL and HSL was less in TN and HS barrows than in PFTN barrows (P ≤ 0.041). The abundance of SCD mRNA was increased in HS barrows compared with TN barrows (P = 0.047). After 7 d of dietary treatment, mRNA abundance of FASN and SCD decreased in adipose tissue from barrows fed CO compared with barrows consuming the CNTR and TAL diets (P ≤ 0.011; Table 10).


View Full Table | Close Full ViewTable 9.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 on mRNA abundance in adipose tissue on d 74

 
Environment, ΔΔCt6
Fdiff7
Gene Description Primers, 5′–3′5 TN PFTN HS SEM TN vs. PFTN HS vs. TN HS vs. PFTN P-value8
ACLY ATP citrate lyase F: AGGAGGAGTTCTATGTCTGC
R: CAACAGGTGTTTCTTGATGGCC
0.30 −0.64 0.21 0.63 −1.91 1.06 −1.80 0.537
ACSS2 Acyl-CoA synthetase short-chain family member 2 F: TGTGAACCTGAAGGAGCTGG
R: ACAATGCAGCATCTCACTGG
0.23 −0.38 −0.45 0.72 −1.52 1.60 1.05 0.633
ACACA Acetyl CoA carboxylase F: ATGGATGAACCGTCTCCC
R: TGTAAGGCCAAGCCATCC
−0.20 −0.56 0.27 1.25 −1.28 −1.39 −1.78 0.517
FASN Fatty acid synthase F: CACAACTCCAAAGACACG
R: AGGAACTCGGACATAGCG
−0.42 −0.23 −1.15 0.81 1.14 1.66 1.89 0.249
SCD Stearoyl CoA desaturase (delta-9-desaturase) F: TACTATCTGCTGAGTGCTGTGG
R: CTGGAATGCCATCGTGTTGG
0.48a −0.29ab −2.13b 1.19 −1.71 6.11 3.58 0.047
FADS2 Fatty acid desaturase 2 (delta-6-desaturase) F: GCCTTCATCCTTGCTACC
R: AGATGGCCGTAATCGTGC
0.89 −1.02 0.33 1.35 −3.76 1.47 −2.55 0.295
EVOLV6 Fatty acid elongase 6 F: CTGGTTTCTGCTCTGTATGC
R: ACCTGAACACTGCAAGGC
0.63 −0.31 0.80 0.81 −1.91 −1.13 −2.16 0.542
PRKAG1 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit F: TTGGTGACTAATGGTGTCCG
R: TGAAATCAGTGATGGTCAGC
0.36 0.02 0.30 1.84 −1.27 1.04 −1.21 0.889
PLIN1 Perilipin 1 F: GAGTGCTTCCAGAAGACC
R: GATGCCCTTCTCGTAAGC
0.35 0.45 −0.85 1.60 1.07 2.30 2.46 0.418
ATGL
(PNPLA2)
Adipose triglyceride lipase (Patatin-like phospholipase domain containing 2) F: ATCATAACCCACTTCGCC
R: ACACGGGAATGAAGGTGC
0.08a −1.80b 1.15a 0.88 −3.68 −2.10 −7.73 <0.001
HSL Hormone sensitive lipase F: AACGCAATGAAACAGGCC
R: TGTATGATCCGCTCAACTCG
−0.01b −0.36b 1.54a 1.53 −1.27 −2.93 −3.73 0.041
INSR Insulin receptor F: CGACCATCTGTAAGTCGC
R: GTCTTGGAAGTGGTAGTAGG
−0.39 0.40 −0.02 0.81 1.73 −1.29 1.33 0.823
a,bWithin a row, least squares means lacking a common superscript differ (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4No interaction between environment and dietary fat was evident (P ≥ 0.15).
5F = forward sequence; R = reverse sequence.
6Delta delta cycle threshold (Ct).
7Fdiff = fold difference; positive/negative values indicate increased/decreased mRNA abundance.
8Probability value for main effect of environment.

View Full Table | Close Full ViewTable 10.

Effects of a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on mRNA abundance in adipose tissue on d 71

 
Dietary fat, ΔΔCt3
Fdiff4
Gene Description Primers, 5′–3′2 CNTR TAL CO SEM CNTR vs. TAL CO vs. CNTR CO vs. TAL P-value5
ACLY ATP citrate lyase F: AGGAGGAGTTCTATGTCTGC
R: CAACAGGTGTTTCTT GATGGCC
−0.04 0.78 −0.85 0.63 1.76 1.75 3.10 0.201
ACSS2 Acyl-CoA synthetase short-chain family member 2 F: TGTGAACCTGAAGGAGCTGG
R: ACAATGCAGCATCTCACTGG
−0.81 0.52 −0.33 0.72 2.51 −1.39 1.80 0.215
ACACA Acetyl CoA carboxylase F: ATGGATGAACCGTCTCCC
R: TGTAAGGCCAAGCCATCC
0.15 0.02 −0.66 1.25 −1.09 1.75 1.60 0.566
FASN Fatty acid synthase F: CACAACTCCAAAGACACG
R: AGGAACTCGGACATAGCG
−0.36a 0.20a −1.64b 0.81 1.47 2.43 3.58 0.011
SCD Stearoyl CoA desaturase (delta-9-desaturase) F: TACTATCTGCTGAGTGCTGTGG
R: CTGGAATGCCATCGTGTTGG
0.11a 0.90a −2.94b 1.18 1.72 8.28 14.32 0.002
FADS2 Fatty acid desaturase 2 (delta-6-desaturase) F: GCCTTCATCCTTGCTACC
R: AGATGGCCGTAATCGTGC
0.83 −0.49 −0.14 1.34 −2.50 1.96 −1.27 0.474
EVOLV6 Fatty acid elongase 6 F: CTGGTTTCTGCTCTGTATGC
R: ACCTGAACACTGCAAGGC
1.16 0.45 −0.48 0.82 −1.63 3.11 1.91 0.309
PRKAG1 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit F: TTGGTGACTAATGGTGTCCG
R: TGAAATCAGTGATGGTCAGC
0.69 0.21 −0.22 1.84 −1.39 1.88 1.35 0.444
PLIN1 Perilipin 1 F: GAGTGCTTCCAGAAGACC
R: GATGCCCTTCTCGTAAGC
0.51 0.90 −1.46 1.60 1.31 3.92 5.13 0.101
ATGL
(PNPLA2)
Adipose triglyceride lipase (Patatin-like phospholipase domain containing 2) F: ATCATAACCCACTTCGCC
R: ACACGGGAATGAAGGTGC
0.04 0.31 −0.92 0.88 1.21 1.95 2.35 0.258
HSL Hormone sensitive lipase F: AACGCAATGAAACAGGCC
R: TGTATGATCCGCTCAACTCG
0.13 0.36 0.68 1.53 1.17 −1.46 −1.25 0.807
INSR Insulin receptor F: CGACCATCTGTAAGTCGC
R: GTCTTGGAAGTGGTAGTAGG
0.91 −0.04 −0.88 0.81 −1.93 3.46 1.79 0.313
a,bWithin a row, least squares means lacking a common superscript differ (P < 0.05).
1No interaction between environment and dietary fat was evident (P ≥ 0.15).
2F = forward sequence; R = reverse sequence.
3Delta delta cycle threshold (Ct).
4Fdiff = fold difference; positive/negative values indicate increased/decreased mRNA abundance.
5Probability value for main effect of dietary fat.


DISCUSSION

Pigs poorly dissipate heat, are highly insulated, lack functional sweat glands, and are densely housed during late finishing, causing a high risk of susceptibility to HS (White et al., 2008; Qu et al., 2015). Heat stress imposes substantial changes in the physiological status of pigs, such as acid–base homeostasis (Patience et al., 2005), and is noted for suppressing feed intake (Hao et al., 2014; Pearce et al., 2014) and, therefore, energy intake of the pig (Renaudeau et al., 2013). Heat stress has a greater impact on pigs with a high rate of lean gain, resulting in reduced carcass lean gain and protein accretion (Nienaber et al., 1997; Brown-Brandl et al., 2000). Due to HS shifting the ratio of protein accretion to lipid deposition and the reduced protein accretion rate, the AA requirement for TN pigs may be different than for HS pigs (Nienaber et al., 1997; Kerr et al., 2003). This assumes that the efficiency with which pigs use dietary AA does not change under HS conditions.

To alleviate HS suppressing feed intake, producers typically formulate diets on a seasonal basis using ingredients with a low heat increment and greater energy density during the summer months (Stahly et al., 1981). Dietary fats and oils are ideal for meeting this ingredient description (Forbes and Swift, 1944; Kerr et al., 2015) and are, therefore, used more frequently and at higher dietary concentrations during the seasonally warm periods of the year. Unexpectedly, the data reported herein show that the pig’s response to dietary fat is similar whether housed in a TN or a HS environment. Therefore, these data indicate that producers can anticipate that the inclusion of dietary fat in HS conditions will result in the same outcomes as including dietary fat in TN conditions.

However, it must be noted that although HS suppressed dietary energy intake by approximately 30% in comparison with contemporaries raised in TN conditions, the energy intake of HS barrows was still relatively high for this size of pig (Patience, 2012). This high energy intake is probably due to this experiment being conducted using pigs with a high health status housed in individual pens, where other stressors outside of ambient room temperature were kept to a minimum (White et al., 2015).

Certainly, the response to dietary energy intake is not easy to predict (Collins et al., 2009; Beaulieu et al., 2009), and it recently has been suggested that pigs that consume less energy are more likely to respond to increases in dietary energy concentration (Patience, 2012). Therefore, the data reported herein should be complemented with data collected under differing feed intake conditions, including those representative of the industry, where daily ME intake for pigs of this size may be between 9.0 (Graham et al., 2014) and 9.7 Mcal ME/d (T. A. Kellner, personal communication).

Heat stress barrows had decreased mRNA abundance of genes involved in the lipolytic cascade (adipose triglyceride lipase and hormone sensitive lipase), which, similarly, was found by Sanz Fernandez et al. (2015a). These lipases hydrolyze fatty acids from the stored triglycerides in adipose tissue to be utilized as energetic fuel for protein accretion and maintenance processes throughout the body (Zimmermann et al., 2004). This result provides mechanistic evidence as to why HS pigs have decreased muscle mass and increased adiposity, a phenotype that has been demonstrated in HS pigs for nearly half a century (Close and Mount, 1971; Bridges et al., 1998). However, we did not find any upstream alteration of the lipolysis pathway via quantifying mRNA abundance of the AMPK regulatory subunit that has be implicated in regulating lipolytic lipases (Gaidhu et al., 2012; Sanz Fernandez et al., 2015a). The retention of stored triglycerides in adipose tissue during HS when energy intake is decreased is the opposite of what occurs during TN conditions when energy intake is decreased; unexpectedly, under TN conditions, there is a classic catabolic response where stored lipids are mobilized and circulating NEFA concentrations and whole-body oxidation is increased (Vernon, 1992). Reduced lipolysis in adipose tissue may be an attempt to reduce thermogenesis during mitochondrial fatty acid transport and β-oxidation (Mujahid and Furuse, 2008). Another potential explanation is insulin, an acute anabolic and antilipolytic hormone, which circulating concentrations are increased to which increased concentrations have been reported in a variety of species during HS (Baumgard and Rhoads, 2013).

Previous research has indicated that HS in pigs is not simply a suppression of lipolysis; it directly suppresses protein accretion and the rate of lean carcass gain (Nienaber et al., 1997) and results in a whole-body alteration of nutrient partitioning to a phenotype of increased adiposity due to increased insulin activity (Pearce et al., 2013; Sanz Fernandez et al., 2015a,b). An increase in whole-body insulin action is a conserved HS response across a multitude of species (Baumgard and Rhoads, 2013). Recent findings support this whole-body change in HS pigs. For example, Qu et al. (2015) found that HS increased the expression of genes involved in de novo lipogenesis and fatty acid uptake in adipose tissue, and Sanz Fernandez et al. (2015b) found that HS increased whole-body insulin sensitivity. Furthermore, in utero HS alters the hierarchy of future nutrient partitioning, resulting in a fatter phenotype at market (Johnson et al., 2015).

The direction of storing recently digested dietary lipids and retaining stored body lipids versus mobilizing and then utilizing lipids as an energy source for protein deposition and maintenance processes may explain why HS pigs are less caloric efficient. The energetic cost of a gram of deposited lipid is approximately 1.6 kcal of ME more than a gram of deposited protein (van Milgen and Noblet, 2003; Barea et al., 2010; Patience, 2012).

Despite HS altering lipid metabolism and increasing mRNA abundance of stearoyl CoA desaturase (delta-9-desaturase) in adipose tissue, HS had no significant effect on the carcass IV and fatty acid composition on d 7 or 21 or at market (d 35). This suggests that any seasonal pork fat quality issues are most likely due to decreased carcass weight and belly weight and thickness and not due to HS resulting in carcass fat with increased concentrations of unsaturated fatty acids. A recent finding by Seibert et al. (2015) demonstrated that adipose tissue of HS pigs contained a greater percentage of water than their TN contemporaries, which is consistent with pigs that are limit fed or leaner in phenotype having less lipids relative to water, indicative of small adipocyte size (Gnaedinger et al., 1963). Seibert et al. (2015) also reported that exposure to HS did not alter the fatty acid profile of adipose tissue. Similar to the data reported herein, White et al. (2008) found that when stocking density was adequate, HS increased stearoyl CoA desaturase mRNA abundance but did not alter fatty acid synthase or carcass IV. However, when floor space was reduced from 0.93 m2/pig to 0.66 m2/pig in combination with HS, there was a further decrease in energy intake and a significant increase in adipose tissue stearoyl CoA desaturase mRNA abundance, fatty acid synthase mRNA abundance, and carcass IV by approximately 4 g/100g (White et al., 2008). Under commercial stocking densities (e.g., 0.70 m2/pig), carcass IV values can be 2 to 10 g/100g greater than individually fed pigs under TN conditions (Kellner et al., 2016). Therefore, HS pigs densely stocked in commercial production maybe at a greater risk of exceeding carcass IV standards. An interaction between stocking density and HS was also reported to reduce rate of gain (Kerr et al., 2005). In sum, these studies suggest that if HS pigs have adequate floor space and additional stressors are minimal, the pig can sustain a minimum level of energy intake such that no impact of carcass IV will be evident.

Pigs that are limit fed have been noted to have carcasses that are leaner and have greater carcass IV (Madsen et al., 1992). The data herein agree with this phenotype. as the PFTN carcasses tended to be leaner and had numerically higher carcass IV than TN and HS carcasses.

Since the first demonstration by Ellis and Isbell (1926), it has become accepted that the fatty acid composition of carcass fat will be highly reflective of the dietary fatty acid composition (Apple et al., 2009; Kellner et al., 2015). The data reported herein reveal that the degree of unsaturation in dietary fat also modulates genes involved in de novo lipogenesis (Jump, 2002; Duran-Montgé et al., 2009). Use of an unsaturated dietary fat (CO) versus a saturated fat (TAL) increased the mRNA abundance of fatty acid synthase. It has been demonstrated that dietary SFA, in comparison with unsaturated fatty acids and, in particular, omega-6 fatty acids, suppress fatty acid synthase and de novo lipogenesis (Waterman et al.; 1975, Kouba et al., 1999; Duran-Montgé et al., 2009). Dietary SFA suppressing lipogenesis is not always a consistent response, as Hsu et al. (2004) has shown; in their study, the mRNA abundance of fatty acid synthase was similar between diets with TAL or docosahexaenoic acid. Similarly, Allee et al. (1972) showed that CO and TAL suppressed lipogenesis to the same degree. De novo lipogenesis in the pig synthesizes SFA or MUFA of either 16 or 18 carbons (Kloareg et al., 2007). Therefore, feeding a saturated fat source would suppress the further production of similar SFA and MUFA via lipogenesis and feeding an unsaturated dietary fat source would not have the same effect.

Heat stress has been reported to compromise the pig’s intestinal integrity and morphology (Pearce et al., 2014); these negative effects are largely independent of reduced feed intake (Pearce et al., 2015). The data reported herein indicate that the differences between HS and TN barrows in terms of the ATTD of GE and AEE were minimal after 17 d of HS exposure and that there was no significant difference evident for TTTD of AEE. The use of CO resulted in greater ATTD of GE and AEE and TTTD of AEE. The increase in digestibility of a more unsaturated dietary fat source versus a saturated fat source has been previously shown (Wiseman et al., 1990; Kerr et al., 2009; Kil et al., 2010). However, more work is needed to validate if unsaturated dietary fat sources have increased levels of DE and ME than saturated fat sources (Powles et al., 1995; NRC, 2012).

In conclusion, HS does not alter the pig’s response to dietary fat. However, HS results in reduced growth, feed intake, and caloric and feed efficiency and a suppression of mRNA abundance of genes involved in the lipolytic cascade, which may contribute to fatter carcasses.

 

References

Footnotes


Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.