View Full Table | Close Full ViewTable 1.

Ingredient composition (as-fed basis) of the experimental diets formulated with no added fat (control), 3% corn oil, or 3% tallow

 
Ingredient, % Control 3% Corn oil 3% Tallow
Corn 84.36 79.74 79.74
Soybean meal (46.5% CP) 12.71 14.35 14.35
Corn oil 3.00
Tallow 3.00
Limestone 0.90 0.90 0.90
Monocalcium phosphate 0.56 0.53 0.53
Salt 0.50 0.50 0.50
l-Lysine HCL 0.15 0.15 0.15
dl-Methionine 0.01 0.01
l-Threonine 0.01 0.01 0.01
Vitamin premix1 0.20 0.20 0.20
Trace mineral premix2 0.15 0.15 0.15
Titanium dioxide 0.40 0.40 0.40
Santoquin3 0.06 0.06 0.06
Formulated composition
    Standard ileal digestible AA, %
        Lysine 0.61 0.64 0.64
        Methionine 0.20 0.21 0.21
        Methionine + cysteine 0.41 0.42 0.42
        Threonine 0.39 0.41 0.41
        Tryptophan 0.12 0.12 0.12
Calculated composition
    NE, Mcal/kg 2.54 2.67 2.67
    Heat increment,4 Mcal/kg 1.16 1.34 1.18
    ME,5 Mcal/kg 3.70 3.90 3.85
Analyzed composition
    DM, % 88.65 89.01 88.39
    GE, Mcal/kg 3.81 4.01 3.95
    CP (N × 6.25), % 13.16 13.56 13.55
    Crude fat, % 3.18 6.21 6.22
    Dietary fat IV,6 g/100g 123.0 41.8
    Diet IV,7 g/100g 117.9 120.8 84.6
    Diet IVP8 37.5 75.0 52.6
1Provided 6,614 IU vitamin A, 827 IU vitamin D, 26 IU vitamin E, 2.6 mg vitamin K, 29.8 mg niacin, 16.5 mg pantothenic acid, 5.0 mg riboflavin, and 0.023 mg vitamin B12 per kilogram of diet.
2Provided 165 mg Zn (zinc sulfate), 165 mg Fe (iron sulfate), 39 mg Mn (manganese sulfate), 17 mg Cu (copper sulfate), 0.3 mg I (calcium iodate), and 0.3 mg Se (sodium selenite) per kilogram of diet.
3Santoquin Mixture 6 (feed and forage antioxidant; Novus International, St. Charles, MO).
4Heat increment = ME NE
5ME = DE × [1.003 (0.0021 × CP)] (Noblet and Perez, 1993).
6Iodine value (IV) determined via titration (Barrow-Agee Laboratories, LLC, Memphis, TN).
7Iodine value calculated from fatty acid composition: IV = [C16:1] × 0.95 + [C18:1] × 0.86 + [C18:2] × 1.732 + [C18:3] × 2.616 + [C20:1] × 0.785 + [C22:1] × 0.723; brackets indicate concentration (AOCS, 1998).
8Iodine value product (IVP) = (IV of the dietary lipids) × (% dietary lipid) × 0.10 (Christensen, 1962; Madsen et al., 1992).



View Full Table | Close Full ViewTable 2.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on daily respiration rate (RR), rectal temperature (RT), growth performance, and feed efficiency from d 0 to 35

 
Environment
Dietary fat
E×DF4
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
Initial BW, kg5 101.5 99.9 100.5 0.9 0.406 100.6 101.2 100.0 0.9 0.644 0.903
Final BW, kg6 137.0 127.2 125.0 1.3 <0.001 129.5 131.1 128.6 1.3 0.366 0.867
RR, breaths/min 36.3b 34.2b 78.3a 1.6 <0.001 50.2 49.0 49.6 1.7 0.692 0.904
RT, °C 38.1b 38.2b 39.0a 0.1 <0.001 38.4 38.4 38.5 0.1 0.653 0.192
ADG, kg 1.03a 0.77b 0.72b 0.03 <0.001 0.83 0.87 0.83 0.03 0.492 0.413
ADFI, kg 3.46a 2.49b 2.49b 0.10 <0.001 2.89 2.82 2.72 0.10 0.124 0.978
G:F 0.301ab 0.319a 0.290b 0.013 0.006 0.292 0.314 0.303 0.013 0.073 0.500
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Probability value for environment × dietary fat interaction (E×DF).
5d 0.
6d 35.



View Full Table | Close Full ViewTable 3.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on energy intake and caloric efficiency

 
Environment
Dietary fat
E×DF4
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
ME intake, Mcal/d 13.1a 9.6b 9.5b 0.4 <0.001 10.7 11.0 10.4 0.4 0.090 0.990
ME intake:BW gain 12.8ab 12.2b 13.4a 0.7 0.013 12.8 12.6 13.0 0.7 0.654 0.477
ME intake:carcass gain 17.2ab 16.6b 18.1a 1.0 0.021 17.4 17.1 17.5 1.0 0.786 0.509
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment, P < 0.05.
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Probability value for environment × dietary fat interaction (E×DF).



View Full Table | Close Full ViewTable 4.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on apparent total tract digestibility (ATTD)4 and true total tract digestibility (TTTD)5 of DM, GE, and acid hydrolyzed ether extract (AEE)

 
Environment
Dietary fat
E×DF6
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
ATTD, %
    DM 88.0 88.7 88.4 0.2 0.223 88.4 88.5 88.2 0.2 0.524 0.253
    GE 88.2b 89.1a 88.8a 0.2 0.008 88.4y 89.1x 88.6y 0.2 0.011 0.525
    AEE 60.2 61.4 59.0 0.8 0.055 41.5z 71.2x 67.8y 0.8 <0.001 0.886
TTTD, %
    AEE 97.9 98.5 96.7 0.7 0.118 97.3y 99.3x 96.3y 0.7 0.012 0.932
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment (P < 0.05).
x–zWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Apparent total tract digestibility (%) of either AEE, DM, or GE was calculated as 100 {100 × [concentration (g) of TiO2 in diet × concentration of (g) of AEE, DM, or GE in feces]/[concentration (g) of TiO2 in feces × concentration of AEE, DM, or GE in diet]}; (Oresanya et al. 2007).
5Calculated via correcting ATTD of AEE for endogenous fat losses at 20 g AEE/kg DM intake.
6Probability value for environment × dietary fat interaction (E×DF).



View Full Table | Close Full ViewTable 5.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on carcass characteristics

 
Environment
Dietary fat
E×DF4
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
HCW, kg 101.5a 93.1b 92.1b 1.2 <0.001 95.2 96.5 95.1 1.2 0.554 0.827
Yield, % 74.1 73.2 73.7 0.4 0.096 73.5 73.6 74.0 0.4 0.407 0.600
Loin depth, cm 6.23 5.95 5.97 0.23 0.261 6.11x 5.73y 6.30x 0.24 0.006 0.387
Back fat, cm 2.29a 1.99b 2.10b 0.21 0.011 2.19 2.14 2.06 0.21 0.353 0.854
Fat-free lean, % 52.4 53.9 53.2 1.5 0.089 52.9 52.7 52.9 1.6 0.129 0.774
Loin characteristics
    Ultimate pH 5.6 5.6 5.6 0.1 0.873 5.6 5.6 5.7 0.1 0.199 0.640
    LCS5 3.2 3.0 3.1 0.1 0.561 3.0 3.1 3.1 0.1 0.806 0.693
    LMS6 1.8 1.8 1.7 0.1 0.495 1.7 1.7 1.8 0.1 0.829 0.515
Belly characteristics
    Belly weight, kg 8.6a 7.5b 7.8b 0.2 <0.001 8.0xy 8.3x 7.7y 0.2 0.018 0.372
    Belly ET,7 cm 3.11 2.81 2.76 0.25 0.055 2.94 2.88 2.86 0.25 0.856 0.313
    Belly MT,8 cm 2.47a 2.23b 2.20b 0.08 0.029 2.28 2.36 2.25 0.08 0.568 0.919
    l* 71.8b 73.2a 73.4a 0.6 0.021 73.4 72.6 72.4 0.6 0.177 0.309
    a* 11.6a 9.9b 10.4b 0.4 0.003 10.3 10.7 10.9 0.4 0.452 0.318
    b 7.7 7.3 7.4 0.2 0.303 7.3 7.6 7.5 0.2 0.210 0.215
    Durometer 44.4 41.9 42.7 2.5 0.682 44.7 42.6 41.8 2.4 0.547 0.687
    Belly firmness9 2.2 2.4 2.4 0.1 0.243 2.3 2.5 2.2 0.1 0.220 0.720
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment (P < 0.05).
x,yWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Probability value for environment × dietary fat interaction (E×DF).
5LCS = loin color score; evaluated postmortem according to the Japanese color bar 1 to 6 scale: 1 = extremely light and 6 = extremely dark (Sullivan et al., 2007).
6LMS = loin marbling score; evaluated postmortem according to national pork board standards (NPPC, 2000). The marbling standards correspond to percentage of intramuscular lipid.
7ET = edge thickness; measured in the middle scribe side of the belly.
8MT = middle thickness; measured in the middle of the belly.
9Measured by a subjective flop test with a score of 1, 2, or 3, with 1 being the firmest.



View Full Table | Close Full ViewTable 6.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on fatty acid profile and calculated iodine value (IV)4 of jowl fat on d 7

 
Environment
Dietary fat
E×DF5
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
Fatty acid,6 %
    C12:0, % 0.04 0.04 0.04 0.01 0.655 0.04 0.04 0.04 0.01 0.925 0.112
    C13:0, % 0.04 0.04 0.04 0.01 0.623 0.04 0.04 0.04 0.01 0.936 0.372
    C14:0, % 1.10 1.05 1.12 0.02 0.055 1.11 1.06 1.10 0.02 0.210 0.557
    C15:0, % 0.04 0.04 0.04 0.01 0.516 0.03 0.04 0.04 0.01 0.592 0.398
    C16:0, % 22.37 22.03 22.36 0.20 0.440 22.41 22.25 22.09 0.20 0.525 0.566
    C16:1, % 2.44 2.22 2.32 0.13 0.270 2.46 2.29 2.23 0.13 0.169 0.848
    C17:0, % 0.54 0.55 0.53 0.07 0.845 0.54 0.52 0.56 0.07 0.477 0.786
    17:1, % 0.36 0.36 0.37 0.04 0.882 0.37 0.35 0.38 0.04 0.323 0.372
    C18:0, % 10.83 11.23 11.20 0.34 0.461 10.98 11.13 11.15 0.34 0.861 0.475
    C18:1, % 44.36 44.61 43.66 0.35 0.101 44.50 43.63 44.50 0.35 0.140 0.063
    C18:2, % 14.80 14.86 15.23 0.36 0.527 14.51 15.55 14.84 0.36 0.093 0.752
    C18:3, % 0.63 0.64 0.67 0.03 0.117 0.64 0.66 0.65 0.03 0.556 0.957
    C20:0, % 0.12 0.09 0.14 0.03 0.250 0.08 0.13 0.14 0.03 0.124 0.291
    C20:1, % 0.93 0.92 0.90 0.06 0.468 0.93 0.89 0.93 0.06 0.305 0.495
    C20:2, % 0.78 0.79 0.76 0.03 0.659 0.77 0.80 0.77 0.03 0.669 0.444
    C20:3, % 0.11 0.09 0.09 0.01 0.369 0.07y 0.10xy 0.12x 0.01 0.039 0.760
    C22:1, % 0.30 0.30 0.30 0.02 0.958 0.29 0.30 0.29 0.02 0.814 0.450
    Other SFA, % 0.15a 0.11b 0.14a 0.02 0.014 0.13 0.13 0.13 0.02 0.939 0.186
    Other UFA,7 % 0.07 0.05 0.04 0.01 0.060 0.05 0.05 0.06 0.01 0.795 0.194
U:S8 1.84 1.85 1.81 0.03 0.544 1.83 1.83 1.84 0.03 0.956 0.311
IV, g/100g 68.7 68.8 68.8 0.50 0.976 68.4 69.3 68.7 0.05 0.425 0.929
n-3:n-6 fatty acid ratio9 0.049 0.048 0.049 0.003 0.563 0.048 0.048 0.050 0.003 0.167 0.757
a,bWithin a row, least squares means lacking a common superscript letter differ due to effect of environment (P < 0.05).
x,yWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Iodine value was calculated by [C16:1] × 0.95 + [C18:1] × 0.86 + [C18:2] × 1.732 + [C18:3] × 2.616 + [C20:1] × 0.785 + [C22:1] × 0.723; brackets indicate percentage concentration (AOCS, 1998).
5Probability value for environment × dietary fat interaction (E×DF).
6Lauric acid (C12:0), tridecanoic acid (C13:0), myristic acid (C14:0), pentadecanoic acid (C15:0), palmitic acid (C16:0), palmitoleic acid (C16:1), margaric acid (C17:0), heptadecenoic acid (C17:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), gadoleic acid (C20:1), eicosadienoic acid (C20:2), eicosatrienoic acid (C20:3), and docosenoic acid (C22:1).
7UFA = unsaturated fatty acids.
8U:S = unsaturated to saturated fatty acid ratio.
9Omega-3 fatty acid to omega-6 fatty acid ratio.



View Full Table | Close Full ViewTable 7.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on fatty acid profile and calculated iodine value (IV)4 of jowl fat on d 21

 
Environment
Dietary fa
t
E×DF5
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
Fatty acid,6 %
    C12:0, % 0.05 0.04 0.04 0.01 0.102 0.05 0.04 0.04 0.01 0.479 0.829
    C13:0, % 0.04 0.03 0.05 0.01 0.158 0.04 0.04 0.04 0.01 0.917 0.986
    C14:0, % 1.13 1.07 1.12 0.03 0.109 1.12 1.10 1.10 0.03 0.785 0.454
    C15:0, % 0.04 0.03 0.03 0.01 0.867 0.03 0.04 0.03 0.01 0.886 0.949
    C16:0, % 22.22 21.80 21.90 0.20 0.370 22.18 21.73 22.00 0.20 0.294 0.768
    C16:1, % 2.57 2.43 2.46 0.11 0.574 2.47 2.49 2.51 0.11 0.951 0.382
    C17:0, % 0.49 0.47 0.51 0.05 0.540 0.48 0.48 0.51 0.05 0.496 0.264
    C17:1, % 0.34 0.35 0.36 0.04 0.525 0.36 0.33 0.36 0.04 0.311 0.778
    C18:0, % 10.44 10.49 10.42 0.36 0.970 10.64 10.12 10.58 0.36 0.162 0.662
    C18:1, % 45.91 46.06 45.36 0.49 0.349 45.73xy 45.01y 46.60x 0.49 0.022 0.251
    C18:2, % 13.78 14.24 14.65 0.36 0.197 13.89y 15.57x 13.20y 0.36 <0.001 0.473
    C18:3, % 0.58 0.61 0.63 0.03 0.125 0.61 0.63 0.58 0.03 0.124 0.818
    C20:0, % 0.11 0.09 0.12 0.03 0.659 0.10 0.09 0.14 0.03 0.420 0.810
    C20:1, % 0.99 0.98 0.96 0.06 0.697 0.98 0.95 1.01 0.06 0.340 0.194
    C20:2, % 0.72 0.77 0.75 0.04 0.696 0.73 0.77 0.74 0.04 0.717 0.159
    C20:3, % 0.10 0.08 0.09 0.02 0.618 0.10 0.08 0.09 0.02 0.449 0.149
    C22:1, % 0.26 0.27 0.27 0.02 0.848 0.26 0.27 0.27 0.02 0.857 0.310
    Other SFA, % 0.12 0.11 0.13 0.01 0.238 0.13 0.12 0.12 0.01 0.537 0.508
    Other UFA,7 % 0.07 0.05 0.05 0.01 0.134 0.05 0.05 0.06 0.01 0.804 0.169
U:S8 1.90 1.94 1.92 0.04 0.659 1.88 1.97 1.90 0.04 0.063 0.812
IV, g/100g 68.3 69.2 69.3 0.7 0.259 68.3y 70.6x 67.8y 0.7 <0.001 0.960
n-3:n-6 fatty acid ratio9 0.048 0.048 0.048 0.004 0.860 0.050x 0.045y 0.049x 0.004 <0.001 0.146
x,yWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Iodine value was calculated by [C16:1] × 0.95 + [C18:1] × 0.86 + [C18:2] × 1.732 + [C18:3] × 2.616 + [C20:1] × 0.785 + [C22:1] × 0.723; brackets indicate percentage concentration (AOCS, 1998).
5Probability value for environment × dietary fat interaction (E×DF).
6Lauric acid (C12:0), tridecanoic acid (C13:0), myristic acid (C14:0), pentadecanoic acid (C15:0), palmitic acid (C16:0), palmitoleic acid (C16:1), margaric acid (C17:0), heptadecenoic acid (C17:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), gadoleic acid (C20:1), eicosadienoic acid (C20:2), eicosatrienoic acid (C20:3), and docosenoic acid (C22:1).
7UFA = unsaturated fatty acids.
8U:S = unsaturated to saturated fatty acid ratio.
9Omega-3 fatty acid to omega-6 fatty acid ratio.



View Full Table | Close Full ViewTable 8.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 and a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on fatty acid profile and calculated iodine value (IV)4 of jowl fat on d 35

 
Environment
Dietary fat
E×DF5
Treatment
Treatment
Item TN PFTN HS SEM P-value CNTR CO TAL SEM P-value P-value
Fatty acid,6 %
    C12:0, % 0.04 0.04 0.04 0.01 0.315 0.04 0.04 0.04 0.01 0.913 0.710
    C14:0, % 1.11 1.04 1.08 0.03 0.257 1.08 1.07 1.08 0.03 0.902 0.955
    C15:0, % 0.04 0.04 0.03 0.01 0.294 0.03 0.04 0.04 0.01 0.054 0.168
    C16:0, % 21.88 21.36 21.72 0.19 0.211 21.72 21.47 21.78 0.19 0.508 0.580
    C16:1, % 2.39 2.24 2.36 0.08 0.338 2.41 2.26 2.31 0.08 0.327 0.477
    C17:0, % 0.38 0.41 0.40 0.04 0.427 0.38 0.39 0.42 0.04 0.089 0.129
    C17:1, % 0.36 0.38 0.36 0.03 0.492 0.36 0.36 0.38 0.03 0.302 0.162
    C18:0, % 10.51 10.43 10.70 0.41 0.529 10.53 10.29 10.82 0.41 0.162 0.138
    C18:1, % 45.88 46.59 45.99 0.45 0.497 47.14x 44.65y 46.67x 0.46 <0.001 0.178
    C18:2, % 14.40 14.41 14.30 0.37 0.961 13.73y 16.30x 13.44y 0.37 <0.001 0.116
    C18:3, % 0.62 0.64 0.64 0.02 0.707 0.60y 0.68x 0.61y 0.03 0.003 0.533
    C20:0, % 0.15 0.15 0.14 0.01 0.600 0.14 0.15 0.15 0.01 0.705 0.167
    C20:1, % 0.94 0.96 0.94 0.03 0.767 0.97 0.92 0.95 0.03 0.351 0.245
    C20:2, % 0.76 0.78 0.76 0.02 0.658 0.73y 0.84x 0.73y 0.02 <0.001 0.494
    C20:3, % 0.11 0.11 0.11 0.01 0.872 0.10 0.11 0.11 0.01 0.127 0.882
    C22:1, % 0.27 0.27 0.28 0.01 0.649 0.26 0.29 0.27 0.01 0.082 0.304
    Other SFA, % 0.11 0.11 0.11 0.01 0.839 0.11 0.11 0.11 0.01 0.965 0.269
    Other UFA,7 % 0.03 0.05 0.03 0.01 0.260 0.03 0.03 0.05 0.01 0.068 0.645
U:S8 1.93 1.98 1.93 0.05 0.370 1.95 1.99 1.91 0.05 0.164 0.185
IV, g/100g 69.3 69.8 69.2 0.7 0.624 68.5y 71.5x 68.2y 0.7 <0.001 0.197
n-3:n-6 fatty acid ratio9 0.050 0.051 0.051 0.003 0.216 0.051y 0.047z 0.053x 0.003 <0.001 0.115
x–zWithin a row, least squares means lacking a common superscript letter differ due to effect of dietary fat (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4Iodine value was calculated by [C16:1] × 0.95 + [C18:1] × 0.86 + [C18:2] × 1.732 + [C18:3] × 2.616 + [C20:1] × 0.785 + [C22:1] × 0.723; brackets indicate percentage concentration (AOCS, 1998).
5Probability value for environment × dietary fat interaction (E×DF).
6Lauric acid (C12:0), tridecanoic acid (C13:0), myristic acid (C14:0), pentadecanoic acid (C15:0), palmitic acid (C16:0), palmitoleic acid (C16:1), margaric acid (C17:0), heptadecenoic acid (C17:1), stearic acid (C18:0), oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), arachidic acid (C20:0), gadoleic acid (C20:1), eicosadienoic acid (C20:2), eicosatrienoic acid (C20:3), and docosenoic acid (C22:1).
7UFA = unsaturated fatty acids.
8U:S = unsaturated to saturated fatty acid ratio.
9Omega-3 fatty acid to omega-6 fatty acid ratio.



View Full Table | Close Full ViewTable 9.

Effects of ad libitum feed intake in thermoneutral (TN) conditions,1 pair-fed thermoneutral (PFTN) conditions,1,2 or heat stress (HS)3 on mRNA abundance in adipose tissue on d 74

 
Environment, ΔΔCt6
Fdiff7
Gene Description Primers, 5′–3′5 TN PFTN HS SEM TN vs. PFTN HS vs. TN HS vs. PFTN P-value8
ACLY ATP citrate lyase F: AGGAGGAGTTCTATGTCTGC
R: CAACAGGTGTTTCTTGATGGCC
0.30 −0.64 0.21 0.63 −1.91 1.06 −1.80 0.537
ACSS2 Acyl-CoA synthetase short-chain family member 2 F: TGTGAACCTGAAGGAGCTGG
R: ACAATGCAGCATCTCACTGG
0.23 −0.38 −0.45 0.72 −1.52 1.60 1.05 0.633
ACACA Acetyl CoA carboxylase F: ATGGATGAACCGTCTCCC
R: TGTAAGGCCAAGCCATCC
−0.20 −0.56 0.27 1.25 −1.28 −1.39 −1.78 0.517
FASN Fatty acid synthase F: CACAACTCCAAAGACACG
R: AGGAACTCGGACATAGCG
−0.42 −0.23 −1.15 0.81 1.14 1.66 1.89 0.249
SCD Stearoyl CoA desaturase (delta-9-desaturase) F: TACTATCTGCTGAGTGCTGTGG
R: CTGGAATGCCATCGTGTTGG
0.48a −0.29ab −2.13b 1.19 −1.71 6.11 3.58 0.047
FADS2 Fatty acid desaturase 2 (delta-6-desaturase) F: GCCTTCATCCTTGCTACC
R: AGATGGCCGTAATCGTGC
0.89 −1.02 0.33 1.35 −3.76 1.47 −2.55 0.295
EVOLV6 Fatty acid elongase 6 F: CTGGTTTCTGCTCTGTATGC
R: ACCTGAACACTGCAAGGC
0.63 −0.31 0.80 0.81 −1.91 −1.13 −2.16 0.542
PRKAG1 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit F: TTGGTGACTAATGGTGTCCG
R: TGAAATCAGTGATGGTCAGC
0.36 0.02 0.30 1.84 −1.27 1.04 −1.21 0.889
PLIN1 Perilipin 1 F: GAGTGCTTCCAGAAGACC
R: GATGCCCTTCTCGTAAGC
0.35 0.45 −0.85 1.60 1.07 2.30 2.46 0.418
ATGL
(PNPLA2)
Adipose triglyceride lipase (Patatin-like phospholipase domain containing 2) F: ATCATAACCCACTTCGCC
R: ACACGGGAATGAAGGTGC
0.08a −1.80b 1.15a 0.88 −3.68 −2.10 −7.73 <0.001
HSL Hormone sensitive lipase F: AACGCAATGAAACAGGCC
R: TGTATGATCCGCTCAACTCG
−0.01b −0.36b 1.54a 1.53 −1.27 −2.93 −3.73 0.041
INSR Insulin receptor F: CGACCATCTGTAAGTCGC
R: GTCTTGGAAGTGGTAGTAGG
−0.39 0.40 −0.02 0.81 1.73 −1.29 1.33 0.823
a,bWithin a row, least squares means lacking a common superscript differ (P < 0.05).
1Constant thermal neutral environment of approximately 24.0°C.
2Limit fed based on HS feed intake on the previous day.
3Diunral heat stress environment of approximately 33.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 0 to 7, approximately 33.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 7 to 14, approximately 34.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 14 to 21, approximately 34.5°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 21 to 28, and approximately 35.0°C between 0800 and 2000 h and approximately 28.0°C between 2000 and 0800 h from d 28 to 35.
4No interaction between environment and dietary fat was evident (P ≥ 0.15).
5F = forward sequence; R = reverse sequence.
6Delta delta cycle threshold (Ct).
7Fdiff = fold difference; positive/negative values indicate increased/decreased mRNA abundance.
8Probability value for main effect of environment.



View Full Table | Close Full ViewTable 10.

Effects of a corn–soybean meal–based diet with 0% added fat (CNTR), CNTR with 3% added tallow (TAL), or CNTR with 3% added corn oil (CO) on mRNA abundance in adipose tissue on d 71

 
Dietary fat, ΔΔCt3
Fdiff4
Gene Description Primers, 5′–3′2 CNTR TAL CO SEM CNTR vs. TAL CO vs. CNTR CO vs. TAL P-value5
ACLY ATP citrate lyase F: AGGAGGAGTTCTATGTCTGC
R: CAACAGGTGTTTCTT GATGGCC
−0.04 0.78 −0.85 0.63 1.76 1.75 3.10 0.201
ACSS2 Acyl-CoA synthetase short-chain family member 2 F: TGTGAACCTGAAGGAGCTGG
R: ACAATGCAGCATCTCACTGG
−0.81 0.52 −0.33 0.72 2.51 −1.39 1.80 0.215
ACACA Acetyl CoA carboxylase F: ATGGATGAACCGTCTCCC
R: TGTAAGGCCAAGCCATCC
0.15 0.02 −0.66 1.25 −1.09 1.75 1.60 0.566
FASN Fatty acid synthase F: CACAACTCCAAAGACACG
R: AGGAACTCGGACATAGCG
−0.36a 0.20a −1.64b 0.81 1.47 2.43 3.58 0.011
SCD Stearoyl CoA desaturase (delta-9-desaturase) F: TACTATCTGCTGAGTGCTGTGG
R: CTGGAATGCCATCGTGTTGG
0.11a 0.90a −2.94b 1.18 1.72 8.28 14.32 0.002
FADS2 Fatty acid desaturase 2 (delta-6-desaturase) F: GCCTTCATCCTTGCTACC
R: AGATGGCCGTAATCGTGC
0.83 −0.49 −0.14 1.34 −2.50 1.96 −1.27 0.474
EVOLV6 Fatty acid elongase 6 F: CTGGTTTCTGCTCTGTATGC
R: ACCTGAACACTGCAAGGC
1.16 0.45 −0.48 0.82 −1.63 3.11 1.91 0.309
PRKAG1 Protein kinase, AMP-activated, gamma 1 non-catalytic subunit F: TTGGTGACTAATGGTGTCCG
R: TGAAATCAGTGATGGTCAGC
0.69 0.21 −0.22 1.84 −1.39 1.88 1.35 0.444
PLIN1 Perilipin 1 F: GAGTGCTTCCAGAAGACC
R: GATGCCCTTCTCGTAAGC
0.51 0.90 −1.46 1.60 1.31 3.92 5.13 0.101
ATGL
(PNPLA2)
Adipose triglyceride lipase (Patatin-like phospholipase domain containing 2) F: ATCATAACCCACTTCGCC
R: ACACGGGAATGAAGGTGC
0.04 0.31 −0.92 0.88 1.21 1.95 2.35 0.258
HSL Hormone sensitive lipase F: AACGCAATGAAACAGGCC
R: TGTATGATCCGCTCAACTCG
0.13 0.36 0.68 1.53 1.17 −1.46 −1.25 0.807
INSR Insulin receptor F: CGACCATCTGTAAGTCGC
R: GTCTTGGAAGTGGTAGTAGG
0.91 −0.04 −0.88 0.81 −1.93 3.46 1.79 0.313
a,bWithin a row, least squares means lacking a common superscript differ (P < 0.05).
1No interaction between environment and dietary fat was evident (P ≥ 0.15).
2F = forward sequence; R = reverse sequence.
3Delta delta cycle threshold (Ct).
4Fdiff = fold difference; positive/negative values indicate increased/decreased mRNA abundance.
5Probability value for main effect of dietary fat.