Search
Author
Title
Vol.
Issue
Year
1st Page

Journal of Animal Science - Animal Nutrition

Nutrient transporters in bovine uteroplacental tissues on days sixteen to fifty of gestation1

 

This article in JAS

  1. Vol. 94 No. 11, p. 4738-4747
     
    Received: July 29, 2016
    Accepted: Sept 06, 2016
    Published: October 27, 2016


    2 Corresponding author(s): matthew.crouse@ndsu.edu
 View
 Download
 Share

doi:10.2527/jas.2016-0857
  1. M. S. Crouse 2*,
  2. K. J. McLean*,
  3. M. R. Crosswhite*,
  4. L. P. Reynolds*,
  5. C. R. Dahlen*,
  6. B. W. Neville,
  7. P. P. Borowicz* and
  8. J. S. Caton*
  1. * Department of Animal Sciences, Center for Nutrition and Pregnancy, North Dakota State University, Fargo 58108
     Central Grasslands Research Extension Center, Streeter, ND 58483

Abstract

During early gestation, nutrients are transported to the developing embryo via transporters in the uterine endometrium and chorioallantois. In the present study, we examined glucose transporters GLUT1 and GLUT3 and the cationic AA transporters SLC7A1, SLC7A2, and SLC7A3 to test the hypotheses that 1) relative mRNA expression of transporters would be different among uteroplacental tissue type as gestation progresses and 2) concentrations of glucose and cationic AA would be different among target sites (placental compartments, serum, and histotrophic) and days of gestation. To test these hypotheses, crossbred Angus heifers (n = 46) were synchronized, bred via AI, and then ovariohysterectomized on d 16, 22, 28, 34, 40, or 50 of gestation (5 to 9/d) or not bred and ovariohysterectomized on d 16 of the synchronized estrous cycle (n = 7) to serve as nonpregnant (NP) controls. Uteroplacental tissues (maternal caruncle [CAR], intercaruncular endometrium [ICAR], and fetal membranes [FM; chorioallantois, d 22 and later]) were collected from the uterine horn ipsilateral to the corpus luteum immediately following ovariohysterectomy. Relative mRNA expression of the glucose transporters and cationic AA transporters was determined for each tissue from d 16 to 50 of gestation and from NP controls. Chorioallantoic, amniotic, and plasma fluids were collected from heifers on d 40 and 50 of gestation to determine concentrations of glucose and cationic AA. Expression of GLUT1 and SLC7A2 showed a tendency (P < 0.10) toward being greater in d 16 ICAR and d 34 ICAR, respectively. Day × tissue interactions (P < 0.05) were present for GLUT3, SLC7A1, and SLC7A3. Expression of GLUT3 was greater in d 50 CAR, expression of SLC7A1 was greater on d 34 in ICAR, and expression of SLC7A3 was greater in CAR tissue on d 34 compared with all other tissues and days of gestation. Glucose concentrations tended (P = 0.10) to be impacted by a day × fluid interaction. A day × fluid interaction (P = 0.01) for arginine concentration was observed, with greater concentrations in allantoic fluid on d 40 compared with all other days and fluid types. These data support our hypothesis that glucose and cationic AA transporters differ in their level of mRNA expression due to day of gestation and uteroplacental tissue type. In addition, concentrations of nutrients were differentially impacted by day, target site, and/or their respective interaction.



INTRODUCTION

Currently, fertilization rates for first-service AI are approximately 90% in beef heifers (Bridges et al., 2013); however, by d 30 of gestation, only 50 to 60% of heifers are gestating viable embryos. Moreover, Thatcher et al. (1994) indicated that up to 80% of all embryonic loss occurs before d 40 of gestation. Nutrient transport across the placenta is the only method of nutrient flux to the embryo during early gestation, and expression of transporters in the interplacentomal region of the placenta provides nutrients via histotroph to the early conceptus (Wooding and Flint, 1994). The presence of nutrient transporters and nutrient flow to the embryo and placenta is crucial for proper development and growth. During the preimplantation period through the establishment of hemotrophic nutrition, the conceptus utilizes increasing quantities of glucose and AA supplied by uterine histotroph (Gardner, 1998; Groebner et al., 2011; Bazer et al., 2014). Histotroph is a mixture of enzymes, growth factors, adhesion proteins, cytokines, hormones, transport proteins, AA, and saccharides that are supplied from the luminal, superficial glandular, and deep glandular epithelium of the uterine endometrium (Bazer, 1975; Roberts and Bazer, 1988; Wang et al., 2014). Inappropriate composition of uterine histotroph may cause improper development of conceptuses (Wang et al., 2014). Therefore, the expression and function of glucose and AA transporters in the uteroplacenta becomes essential to the viability of the conceptus. In this study, we tested the hypotheses that 1) relative mRNA expression of transporters would be differentially expressed due to day of advancing gestation and that transporters would be differentially expressed due to uteroplacental tissue type and 2) concentrations of glucose and cationic AA would be different due to day of gestation and maternal or fetal fluid type.


MATERIALS AND METHODS

All animal procedures were approved by the North Dakota State University Institutional Animal Care and Use Committee.

Animals

Crossbred Angus heifers (n = 46; approximately 15 mo of age; 362.3 ± 34.7 kg BW and 0.22 kg ADG) were fed, once daily, grass hay (90% DM, 10.7% CP, and 38.9% ADF) and supplemented with cracked corn (90% DM, 9.8% CP, and 3.3% ADF) via a Calan Head Gate System (American Calan, Inc., Northwood, NH) and were individually fed to gain 0.25 kg/d. Heifers were obtained from the Central Grasslands Research Extension Center (Streeter, ND; 2.5 h southwest of Fargo) and housed at the North Dakota State University Animal Nutrition and Physiology Center in group pens with 6 heifers in each pen. All heifers were exposed to the 5-d CO-Synch + Controlled Internal Drug Release estrus synchronization protocol (Bridges et al., 2008). Seven heifers were not inseminated to serve as nonpregnant (NP) controls but received an ovariohysterectomy on d 16 of the synchronized estrous cycle. The remaining heifers were bred by AI to a single sire and ovariohysterectomized on d 16 (9 heifers), 22 (6 heifers), 28 (6 heifers), 34 (7 heifers), 40 (6 heifers), or 50 (5 heifers) of gestation. Heifer selection for ovariohysterectomy on d 16 of gestation was by random selection based on inability to confirm pregnancy via ultrasonography, and on hysterectomy, heifers without fetal membranes (FM) were removed from the study. Heifer selection on d 22 was based on no observed estrus by d 21 and localization of a corpus luteum and fetus/fetal fluids via ultrasonography. Heifers on d 28 through 50 of gestation were selected for ovariohysterectomy after being confirmed pregnant via ultrasonography.

Sample Collection and Analysis

Ovariohysterectomy procedures were conducted as described by McLean et al. (2016). Briefly, ovariohysterectomy was conducted as a standing procedure, with a left flank incision. Uterine and ovarian arteries were sutured and ligated, along with sutures being placed along the cervix. The uterus was clamped caudal to the bifurcation and incised along the clamp, thereby collecting the entire uterine body and horns along with the attached ovaries. Immediately following ovariohysterectomy, uteroplacental tissues (caruncle [CAR], intercaruncular endometrium [ICAR], and FM (chorioallantois, d 22 and later]) were separated and individually collected from the uterine horn ipsilateral to the corpus luteum, as previously described (Grazul-Bilska et al., 2010, 2011). Fetal membranes were collected only from d 22 and later due to limited tissue volume present on d 16 and absence of FM in NP controls. Once collected, all tissues were snap frozen in liquid nitrogen–cooled isopentane and stored at −80°C.

Real-time quantitative PCR was done on CAR, ICAR, and FM samples to determine mRNA expression of glucose transporter 1 (GLUT1; facilitative glucose transporter that is found in most tissues throughout the body and is ubiquitous across mammalian species), glucose transporter 3 (GLUT3; facilitative glucose transporter specifically known for neural and placental glucose transport), and cationic AA transporters 1, 2, and 3 (SLC7A1, SLC7A2, and SLC7A3, all of which are facilitated diffusion arginine and lysine transporters). The RNA was extracted and purified using an RNeasy Mini Kit (Qiagen Inc., Valencia, CA), total quantity of RNA was determined using a Take3 module of a Synergy H1 Microplate Reader (BioTek Instruments Inc., Winooski, VT), and cDNA was synthesized using a QuantiTect Reverse Transcription Kit (Qiagen Inc.). Primer sequences (Table 1) for glucose and AA transporters were obtained from GenBank (National Center for Biotechnology Inforamation, Bethesda, MD). The cDNA dilutions were determined by primer validation for each gene and tissue type across stages of gestation. For PCR, dilutions of 1:100 were used for GLUT1 and SLC7A1 and dilutions of 1:10 were used for GLUT3, SLC7A2, and SLC7A3. Gene expression was quantified using a 7500 Fast Real-Time PCR System (Applied Biosystems, Grand Island, NY) with SYBR Green Master Mix (Bio-Rad Laboratories, Hercules, CA; 18 μL total for GLUT1 and SLC7A1 and 15 μL total for GLUT3, SLC7A2, and SLC7A3).


View Full Table | Close Full ViewTable 1.

Primer sets used for real-time quantitative reverse-transcription PCR

 
Gene1 Product size, bp Forward primer (5′–3′) Reverse primer (5′–3′) GenBank accession no. Source
GLUT1 2,533 CGGCTGCCCTGGATGTC GCCTGGGCCCACTTCAAA NM_174602 Mattmiller et al., 2011
GLUT3 1,404 CAAGTCACAGTGCTAGAGTCTTTC GGAGAGCTGGAGCATGATAGAGAT XM_001256170 Mattmiller et al., 2011
SLC7A1 695 CCGATAATCGCCACCTTAACCT ACCAGGTCCTTCAGGTCGAA DQ399522 Liao et al., 2008
SLC7A2 490 AAGGAAATGTGGCAAACT TTGAAAAGCAACCCATCCTC XM_865568.2 Gao et al., 2009b
SLC7A3 473 TACCAGCCTCTTGGGCTCTA AAAGCAGTGGAATGGACCAC BC126655 Gao et al., 2009b
1GLUT1 and GLUT3 = glucose transporter solute carrier family 2 members 1 and 3; SLC7A1, SLC7A2, and SLC7A3 = cationic AA transporters of arginine and lysine, solute carrier family 7 members 1, 2, and 3.

Plasma samples were collected via jugular venipuncture at the time of ovariohysterectomy using 10-mL heparin vacutainer tubes (Becton Dickinson HealthCare, Franklin Lakes, NJ) and centrifuged at 1,500 × g for 30 min at 4 °C. Plasma was separated from blood constituents and stored at −20°C. Allantoic fluid (ALF) was collected by isolating the embryo within the uterine horn and extracting 10 mL of fluid from the chorioallantoic sac using a 22-gauge needle (Medtronic, Minneapolis, MN) to prevent rupture of the sac. Amniotic fluid (AMF) was collected using a 22-gauge needle (Medtronic) inserted through the amnion with suction applied via syringe after the amniotic sac containing the embryo was visualized; 5 mL of fluid was collected from the d-40 embryo and 10 mL of fluid was collected from d-50 embryos. Allantoic and amniotic fluids were collected only on d 40 and 50 of gestation. Once collected, all fluids were snap frozen in liquid nitrogen cooled isopentane and stored at −20°C.

Arginine, ornithine, citrulline, and lysine concentrations were determined using an ACQUITY UPLC System (Waters Corporation, Milford, MA). For ultra performance liquid chromatography (UPLC), 250 μL of fluid was used for plasma, ALF, and AMF. The MassTrac Amino Acid Analysis System for Waters UPLC (Waters Corporation) was used to determine the full profile of AA in physiological fluids. Derivatization chemistry for physiological samples is a precolumn method and is based on a derivatizing reagent, 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate, which converts both primary and secondary AA to stable chromophores for UPLC detection. Glucose concentrations were determined using Infinity Glucose Hexokinase Liquid Stable Reagent (Fisher Diagnostics, Middletown, VA) and analyzed with a Synergy H1 Microplate Reader (BioTek Instruments Inc.). For glucose determination, 5 μL of fluid was used for plasma, ALF, and AMF with 250 μL of reagent (intraplate CV = 2.99 and interplate CV = 2.91).

Statistical Analysis

Day of Gestation Caruncle and Intercaruncular Endometrium.

Data were analyzed for day of gestation effects using the GLM procedure of SAS 9.3 (SAS Inst. Inc., Cary, NC), with individual heifer serving as the experimental unit. Means were separated using the LSMEANS procedure of SAS and P-values ≤ 0.05 were considered different. Effect of day of gestation was determined for each individual tissue (CAR and ICAR) within gene of interest using the NP control values for each tissue as a baseline.

Day of Gestation Fetal Membranes.

Data were analyzed for day of gestation effects using the GLM procedure of SAS 9.3, with individual heifer serving as the experimental unit. Means were separated using the LSMEANS procedure of SAS and P-values ≤ 0.05 were considered different. Due to no NP control for FM, data are given as change in cycle threshold (ΔCt) values after being normalized to β-actin. The lowest ΔCt would yield the highest total expression after the second normalization to a control; however, because there is no FM in a NP animal, there is no second normalization for effect of day of gestation. Therefore, in analysis, a lower ΔCt will be described as having the higher level of expression.

Day × Tissue Interaction.

To evaluate the level of expression of glucose and cationic AA transporters between CAR, ICAR, and FM from d 16 to 50 of gestation, data were analyzed for an interaction between day of gestation (d 16, 22, 28, 34, 40, or 50) and uteroplacental tissue type (CAR, ICAR, and FM) using the GLM procedure of SAS 9.3, with individual heifer serving as the experimental unit. Means were separated using the LSMEANS procedure of SAS and P-values ≤ 0.05 were considered different. Interactions were determined across uteroplacental tissue type and day of gestation using the NP endometrium sample as the baseline. If no significant interaction was present, main effect of tissue was analyzed within gene of interest. Effect of tissue was determined using the GLM procedure of SAS 9.3, with individual heifer serving as the experimental unit. Means were separated using the LSMEANS procedure of SAS and P-values ≤ 0.05 were considered different. The effect of day of gestation given is not an accurate representation of significance within gene due to a magnitude change compared with NP endometrium and was, therefore, conducted as previously discussed to provide an effect of day of gestation without an increased magnitude yielding significance.

Day × Fluid Interaction.

Data were analyzed for an interaction between day of gestation and maternal or fetal fluid type using the GLM procedure of SAS 9.3, with individual heifer serving as the experimental unit. Means were separated using the LSMEANS procedure of SAS and P-values ≤ 0.05 were considered different.


RESULTS

Effects of Day of Gestation

Caruncle.

Expression of GLUT1 was greater (P < 0.01) at d 16 (7.8-fold increase over NP controls) compared with d 22 (4.3-fold increase over NP controls), which was greater (P < 0.05) than the remaining days of early pregnancy and NP controls (SEM 1.0; Table 2). Expression of GLUT3 was greater (P = 0.01) on d 50 (13.68-fold increase over NP controls) of gestation compared with NP controls and d 16, 22, 28, and 40 of gestation (SEM 2.3; Table 2). Additionally, GLUT3 on d 34 was greater (9.13-fold increase over NP controls; P ≤ 0.05) compared with NP controls and d 16 (Table 2). Relative expression of SLC7A1 was greater (P ≤ 0.05) on d 28, 34, and 40 (5.12-, 6.82-, and 5.10-fold increase, respectively, over NP controls) compared with NP controls and d 16, 22, and 50 of gestation (SEM 0.9; Table 2). Day of gestation did not influence SLC7A2 expression (P = 0.20). Expression of SLC7A3 was greater (P = 0.01) on d 16 (6.9-fold greater than NP controls) compared with NP controls and all other days of gestation evaluated (SEM 1.7; Table 2).


View Full Table | Close Full ViewTable 2.

Level of expression of nutrient transporters GLUT1, GLUT3, SLC7A1, SLC7A2, and SLC7A3 in caruncle (CAR) and intercaruncular endometrium (ICAR) tissue in nonpregnant (NP) controls and from d 16 to 50 of gestation1

 
Day of gestation2
Tissue Gene of interest NP 16 22 28 34 40 50 SEM3 P-value4
CAR5 GLUT1 1.00a 7.77c 4.34b 2.06a 1.38a 1.20a 1.70a 1.0 0.0001
GLUT3 1.00a 3.89a 5.62ab 4.80ab 9.13bc 4.93ab 13.68c 2.3 0.01
SLC7A1 1.00a 1.54a 1.99a 5.12b 6.82b 5.10b 0.98a 0.9 0.0001
SLC7A2 1.00 2.38 1.37 0.68 3.24 2.95 0.35 1.0 0.2
SLC7A3 1.00a 6.89b 0.69a 0.42a 0.52a 0.54a 0.14a 1.7 0.01
ICAR6 GLUT1 1.00a 13.24c 6.07b 2.48ab 1.65a 1.04a 0.66a 2.2 0.0001
GLUT3 1.00 0.93 1.67 4.32 4.90 3.51 0.73 1.7 0.06
SLC7A1 1.00a 2.03a 1.63a 6.30b 16.03d 12.02c 5.73b 2.0 0.0001
SLC7A2 1.00a 1.25a 1.23a 7.84bc 10.25c 4.08ab 2.15a 3.1 0.02
SLC7A3 1.00abc 0.50a 0.20a 1.87c 1.49bc 1.46bc 0.61ab 0.5 0.03
a–dMeans within a row without a common superscript differ (P < 0.05).
1GLUT1 and GLUT3 = glucose transporter solute carrier family 2 members 1 and 3; SLC7A1, SLC7A2, and SLC7A3 = cationic AA transporters of arginine and lysine, solute carrier family 7 members 1, 2, and 3.
2Day of gestation is the number of days after insemination. Day 0 is a nonbred NP control and serves as the baseline of expression for that gene. Each gene expression is given as a fold change in relation to NP level of expression.
3The average SEM across all days of gestation and NP heifers was used within gene of interest. Animals ovariohysterecomized on each day are as follows: NP n = 7, d 16 n = 9, d 22 n = 6, d 28 n = 6, d 34 n = 7, d 40 n = 6, d 50 n = 5.
4Probability values for effect of day on level of expression of individual genes. For those with a value of 0.0001, values are <0.0001.
5Caruncular tissue; caruncles taken from the uterine horn ipsilateral to the Corpus Luteum.
6Intercaruncular tissue; endometrial tissue not including caruncles; taken from uterine horn ipsilateral to the Corpus Luteum.

Intercaruncular Endometrium.

Expression of GLUT1 in ICAR followed a pattern similar to that in CAR, with that of d 16 (13.24-fold greater than NP controls) being greater (P < 0.01) than that on all other days measured (SEM 2.2; Table 2). Additionally, d 22 GLUT1 expression was greater (6.07-fold greater than NP controls; P ≤ 0.05) than NP controls or d 34, 40, and 50 of gestation. Relative expression of GLUT3 tended (P = 0.06) to be greater on d 28 and 34 compared with NP controls. On d 34 of gestation, relative expression of SLC7A1 was 16-fold greater (P < 0.01) than NP controls and, on d 40, was still greater (12.02-fold greater than NP controls; P ≤ 0.05) than NP controls or d 16, 22, 28, and 50 of gestation (SEM 2.0; Table 2). Expression of SLC7A2 was greater (P = 0.02) on d 34 (10.25-fold greater than NP controls) compared with NP controls and all other days except d 28 (7.84-fold greater than NP controls), which was greater compared with NP controls and d 16, 22, and 50 (SEM 3.1; P ≤ 0.05; Table 2). Expression of SLC7A3 was greater (P ≤ 0.05) on d 28 (1.87-fold greater than NP controls) compared with d 16, 22, and 50 (SEM 0.5; Table 2). Additionally SLC7A3 in NP controls and d 34 and 40 heifers was greater (P ≤ 0.05) compared with d 16 and 22 heifers (Table 2).

Fetal Membranes.

The expression of GLUT1 was greater (P < 0.01; Table 3) on d 34 and 50 (5.58 and 5.32 ΔCt, respectively) compared with d 22 and 28. Additionally, GLUT1 on d 40 (5.84 ΔCt) was intermediate and greater (P ≤ 0.05) compared with d 22 (SEM 0.3; Table 3). Expression of GLUT3 in FM was similar among all days evaluated (P = 0.72; Table 3). The ΔCt of SLC7A1 was greater (P < 0.01) on d 34 and 50 (6.99 and 7.05 ΔCt, respectively; Table 3) compared with d 22, 28, and 40. Additionally, SLC7A1 on d 28 (8.16 ΔCt) was greater (P ≤ 0.05) compared with d 22 and SLC7A1 on d 40 was equivalent to both d 22 and 28 (SEM 0.4; Table 3). The expression of SLC7A2 was similar throughout early gestation (approximately 5.5 ΔCt; P = 0.14; Table 3). The expression of cationic AA transporter SLC7A3 tended (P = 0.08) to be greater on d 28 (9.64 ΔCt) of gestation (Table 3).


View Full Table | Close Full ViewTable 3.

Level of expression of nutrient transporters GLUT1, GLUT3, SLC7A1, SLC7A2, and SLC7A3 in fetal membranes from d 22 to 50 of gestation.1 Due to no second normalization, data are presented as change in cycle threshold (ΔCt) value2

 
Day of gestation3
Gene of interest 22 28 34 40 50 SEM4 P-value5
GLUT1 6.72a 6.35ab 5.58c 5.84bc 5.32c 0.3 <0.01
GLUT3 6.38 6.06 6.29 6.35 5.66 0.4 0.72
SLC7A1 9.93a 8.16b 7.05c 8.86ab 6.99c 0.4 <0.01
SLC7A2 6.76 6.05 6.09 4.77 5.57 0.6 0.14
SLC7A3 12.25 9.64 10.4 11.61 13.08 0.9 0.08
a–cMeans within a row without a common superscript differ (P < 0.05).
1GLUT1 and GLUT3 = glucose transporter solute carrier family 2 members 1 and 3; SLC7A1, SLC7A2, and SLC7A3 = cationic AA transporters of arginine and lysine, solute carrier family 7 members 1, 2, and 3.
2Lower ΔCt values indicate a higher level of expression.
3Day of gestation is the number of days after insemination. Values for expression of genes are provided as ΔCt values for that gene after being normalized to β-actin.
4The average SEM across all days of gestation was used within gene of interest. Animals ovariohysterecomized on each day are as follows:d 22 n = 6, d 28 n = 6, d 34 n = 7, d 40 n = 6, d 50 n = 5.
5Probability values for effect of day on level of expression of individual genes.

Day × Tissue Interaction

When using NP endometrium as a baseline level of expression of 1.0, a tendency (P = 0.10) for a day × tissue interaction for GLUT1 was observed. In addition, a main effect of tissue was observed, with mean expression of GLUT1 in CAR and ICAR (5.90- and 6.53-fold greater, respectively, than NP endometrium; SEM 0.75) being greater (P < 0.01) than that in FM (Table 4). Expression of GLUT3 was impacted by a day × tissue interaction (P = 0.01) with d 50 CAR having greater expression (24.48-fold greater than NP endometrium; P = 0.01) than d 34 CAR (15.04-fold greater than NP endometrium), which was greater than CAR on all other days or ICAR and FM on all days (Table 4). Cationic AA transporter SLC7A1 expression was greater in day × tissue interaction (P < 0.01) on d 34 in ICAR (11.03-fold greater than NP endometrium) compared with d 40 ICAR (8.27-fold greater than NP endometrium), which was greater (P ≤ 0.05) than ICAR on all other days or CAR and FM on all days (Table 5). Expression of SLC7A2 tended (P = 0.07) to be affected by a day × tissue interaction. In addition, a main effect of tissue was observed in which expression of CAR and ICAR was greater (11.8- and 7.7-fold greater, respectively, than NP endometrium; P < 0.01) compared with FM (2.39-fold greater than NP endometrium; SEM 1.69; Table 5). Relative mRNA expression of SLC7A3 was impacted by day × tissue interaction, being greater (P = 0.02) in CAR on d 16 (28.05-fold greater than NP endometrium) compared with CAR on all other days or ICAR or FM on all days (SEM 4.5; Table 5).


View Full Table | Close Full ViewTable 4.

Level of expression of nutrient transporters GLUT1 and GLUT3 in caruncle (CAR), intercaruncular endometrium (ICAR), and fetal membrane (FM) tissues in nonpregnant (NP) controls and from d 16 to 50 of gestation compared with NP endometrium tissue1

 
Day of gestation2
P-value5
Item NP 16 22 28 34 40 50 Tissue means3 SEM4 Day Tissue Day × tissue
GLUT1 1.9 <0.01 0.02 0.10
    CAR6 0.719 18.929 9.494 3.108 3.009 2.343 3.715 5.90h
    ICAR7 1.711 24.597 10.391 3.297 2.823 1.781 1.131 6.53h
    FM8 0.590 0.642 1.106 0.936 1.307 0.92g
GLUT3 2.7 <0.01 <0.01 0.01
    CAR 1.308abc 6.412abcd 9.254d 7.911bcd 15.044e 8.127cd 24.475f 10.36
    ICAR 0.258a 0.892ab 1.598abc 4.126abcd 5.339abcd 3.353abcd 1.183abc 2.39
    FM 1.407abc 2.105abc 1.956abc 1.774abc 2.494abcd 1.95
a–fMeans within a gene without a common superscript differ in day × tissue (P < 0.05).
g,hMeans different across tissue (P < 0.05).
1GLUT1 and GLUT3 = glucose transporter solute carrier family 2 members 1 and 3.
2Day of gestation is the number of days after insemination. The NP control equals a nonbred, NP control on d 0 and serves as the baseline of expression for that gene. Each gene expression is given as a fold change in relation to NP endometrium level of expression.
3The mean gene expression for the tissue across all days of gestation.
4 The average SEM for the day x tissue interaction was used within gene of interest. Animals ovariohysterecomized on each day are as follows: NP n = 7, d 16 n = 9, d 22 n = 6, d 28 n = 6, d 34 n = 7, d 40 n = 6, d 50 n = 5.
5Probability values for the effect of day, tissue, and day × tissue on level of expression of individual genes.
6Caruncular tissue (caruncles taken from the uterine horn ipsilateral to the Corpus Luteum).
7Intercaruncular tissue; endometrial tissue not including caruncles; taken from uterine horn ipsilateral to the Corpus Luteum.
8Chorioallantois d 22 and later.

View Full Table | Close Full ViewTable 5.

Level of expression of nutrient transporters SLC7A1, SLC7A2, and SLC7A3 in caruncle (CAR), intercaruncular endometrium (ICAR), and fetal membrane (FM) tissues in nonpregnant (NP) controls and from d 16 to 50 of gestation compared with NP endometrium tissue1

 
Day of gestation2
P-value5
Item NP 16 22 28 34 40 50 Tissue means3 SEM4 Day Tissue Day × tissue
SLC7A1 0.8 <0.01 <0.01 <0.01
CAR6 0.671a 1.291a 1.661ab 4.276def 5.699f 4.263cdef 0.687a 2.65
ICAR7 0.688a 1.393a 1.118a 4.330ef 11.026h 8.267g 3.944bcdef 4.40
FM8 0.086a 0.324a 0.624a 0.233a 0.624a 1.89
SLC7A2 4.3 <0.01 <0.01 0.07
CAR 5.718 7.625 7.143 4.25 16.904 10.189 1.841 7.67h
ICAR 1.098 4.856 4.777 19.137 28.267 15.914 8.388 11.78h
FM 1.077 2.761 1.657 3.861 2.605 2.39g
SLC7A3 4.5 <0.01 0.40 0.02
CAR 2.39a 28.049b 2.816a 1.69a 2.132a 2.191a 0.697a 5.71
ICAR 1.55a 0.771a 0.311a 2.9a 2.306a 2.267a 0.203a 1.58
FM 0.61a 1.603a 1.949a 0.634a 0.212a 1.00
a–fMeans within a gene without a common superscript differ in day × tissue (P < 0.05).
g,hMeans different across tissue (P < 0.05).
1SLC7A1, SLC7A2, and SLC7A3 = cationic AA transporters of arginine and lysine, solute carrier family 7 members 1, 2, and 3.
2Day of gestation is the number of days after insemination. The NP control equals a nonbred, NP control on d 0 and serves as the baseline of expression for that gene. Each gene expression is given as a fold change in relation to NP endometrium level of expression.
3The mean gene expression for the tissue across all days of gestation.
4The average SEM for the day x tissue interaction was used within gene of interest. Animals ovariohysterecomized on each day are as follows: NP n = 7, d 16 n = 9, d 22 n = 6, d 28 n = 6, d 34 n = 7, d 40 n = 6, d 50 n = 5.
5Probability values for the effect of day, tissue, and day × tissue on level of expression of individual genes.
6Caruncular tissue; caruncles taken from the uterine horn ipsilateral to the Corpus Luteum.
7Intercaruncular tissue; endometrial tissue not including caruncles; taken from uterine horn ipsilateral to the Corpus Luteum.
8Chorioallantois d 22 and later.

Day × Fluid Interaction

When comparing concentrations of metabolites on d 40 and 50 across maternal plasma, ALF, and AMF, glucose tended (P = 0.10) to be affected by a day × fluid interaction. A main effect of day determined glucose concentrations to be greater (P = 0.05) on d 50 compared with d 40 of gestation (2.76 vs. 2.35 mM, respectively; SEM 0.14; Table 6). Concentration of glucose in plasma was greater (P < 0.01) than both ALF and AMF (4.6 vs. 1.6 and 1.50, respectively; SEM 0.17; Table 6). The concentration of arginine showed a significant day × fluid interaction (P < 0.01), with ALF having greater (P < 0.01) concentrations of arginine on d 40 compared with amniotic and plasma fluids on all other days (Table 6). Concentrations of ornithine, the first catabolite of arginine, were not affected by a day × fluid interaction (P = 0.51) but were greater (P < 0.01) in ALF compared with plasma and AMF (153.58 vs. 70.43 and 69.43 μmol/L, respectively; SEM 7.76; Table 6). Citrulline, which is an additional catabolite of arginine, was not affected by a day × fluid interaction (P = 0.13). There was a main effect of fluid, in which citrulline was greater (P < 0.0001) in maternal plasma, intermediate in ALF, and least in AMF as it was undetected by the UPLC (69.36 and 22.58 μmol/L and undetected, respectively; SEM 3.24; Table 6). Lysine did not show a significant day × fluid interaction (P = 0.31) but showed a main effect of fluid, being greater (P < 0.01) in ALF, intermediate in AMF, and least in plasma (634.50, 236.95, and 99.86 μmol/L, respectively; SEM 28.37; Table 6).


View Full Table | Close Full ViewTable 6.

Glucose, arginine, ornithine, citrulline, and lysine concentrations in allantoic fluid, amniotic fluid, and maternal plasma on d 40 and 50 of gestation

 
Fluid3
P-value6
Nutrient1 Day of
gestation2
Plasma Allantoic Amniotic Day mean4 SEM5 Day Fluid Day × fluid
Glucose 0.2 0.05 <0.01 0.10
40 5.08 1.33 1.06 2.35g
50 4.54 1.81 1.94 2.76h
Fluid mean7 4.59y 1.57x 1.50x
Arginine 58.4 0.03 <0.01 <0.01
40 118.13a 578.41b 164.12a 286.89
50 108.64a 237.97a 186.34a 177.64
Fluid mean 113.39 408.19 175.23
Ornithine 36.4 0.95 <0.01 0.51
40 76.15 154.05 62.35 97.52
50 64.71 153.11 76.51 98.11
Fluid mean 70.43b 153.58a 69.43b
Citrulline
40 73.71 12.54 Undetected 28.75 4.6 0.91 <0.01 0.13
50 65.01 22.58 Undetected 29.19
Fluid mean 69.36a 17.56b Undetectedc
Lysine 39.9 0.80 <0.01 0.31
40 103.07 671.64 209.01 327.91
50 96.65 597.35 264.88 319.63
Fluid mean 99.86x 634.50z 236.95y
a–cMeans within nutrient without a common superscript differ in day × fluid (P < 0.05).
g,hMeans across fluid within day without a common superscript differ (P < 0.05).
x–zMeans across day within fluid without a common superscript differ (P < 0.05).
1Glucose, arginine, ornithine, citrulline, and lysine.
2Day of gestation is the number of days after insemination.
3Concentrations of glucose (mM), arginine (μmol/L), ornithine (μmol/L), citrulline (μmol/L), and lysine (μmol/L) in maternal plasma, allantoic fluid, and amniotic fluid.
4Mean of nutrient concentration across fluid type within a given day of gestation.
5The average SEM for the day x fluid interaction was used within nutrient. Animals ovariohysterecomized on each day are as follows: d 40 n = 6, d 50 n = 5.
6Probability values for the effect of day, fluid, and day × fluid on the concentration of glucose, arginine, ornithine, citrulline, and lysine in fluids.
7Mean of nutrient concentration across day of gestation within a given fluid type.


DISCUSSION

This study is the first to report changes in the mRNA expression of key glucose and cationic AA transporters in bovine uteroplacental tissues from before maternal recognition of pregnancy and implantation through the embryonic stage of development. Results of this study indicate that the expression of glucose and cationic AA transporters in bovine uteroplacental tissues changes dramatically during the first 50 d of gestation in beef heifers. In the current report, facilitative glucose transporters (GLUT1 and GLUT3) and cationic AA transporters (SLC7A1, SLC7A2, and SLC7A3) were all present in uterine tissue, CAR and ICAR, and developing placenta during the first 50 d of gestation as well as in NP uterine tissues. Additionally, these data also demonstrate an effect of day of gestation on the mRNA expression of these genes in bovine uteroplacental tissues as well as maternal and fetal fluid type on the concentration of glucose and arginine.

In sheep endometrium, temporal changes of GLUT1 expression were similar during early gestation, in which GLUT1 was greater during maternal recognition of pregnancy (Gao et al., 2009a) as reported herein. In the Holsteins, however, no effects of day of gestation were seen in the endometrium from d 28 to 42 of gestation (Lucy et al., 2012). Localization of GLUT1 in the ovine endometrium has been determined to be in the luminal epithelium (LE) and superficial glandular epithelium (sGE) of the ovine uterus (Gao et al., 2009a). In the ovine, GLUT1 expression was increased 4.2-fold with progesterone (P4) treatment and 2.1-fold with interferon tau (IFN-τ) infusion (Gao et al., 2009a). In situ hybridization and immunohistochemistry revealed that the effects of P4 and IFN-τ on GLUT1 were mainly localized to the LE and sGE (Gao et al., 2009a). It would be of interest in future studies to determine GLUT1 location in bovine uterine tissues and determine if GLUT1 is a P4-induced and interferon-stimulated gene as it is in the ovine. Expression of GLUT1 in bovine FM increased in level of expression from d 22 to 50 following a differential pattern of expression as seen in maternal uterine tissues. This pattern of expression is also different than what was seen in Holstein cows, in which mRNA concentration of GLUT1 decreased from d 28 to 42 of gestation (Lucy et al., 2012).

In contrast to the pattern of expression for GLUT1 in bovine endometrium, GLUT3 in CAR increased throughout gestation, reaching the peak level of expression on d 50. In the Holstein, however, GLUT3 mRNA was similar from d 28 to 42 of gestation in caruncular tissue (Lucy et al., 2012). Localization of GLUT3 in uterine tissue was established in the rat, in which GLUT3 was localized in both uterine stroma (dense connective tissue) and uterine epithelium, increasing in abundance as gestational day increased (Korgun et al., 2001). Expression of GLUT3 in FM remained consistent as day of gestation increased. Similar results were reported with the ovine model, in which peri-implantation conceptus GLUT3 mRNA was abundant and consistent from d 12 to 20 of gestation (Gao et al., 2009a), and in the Holstein model, in which placental GLUT3 mRNA was abundant and consistent from d 28 to 42 of gestation (Lucy et al., 2012). The known localization of GLUT3 in the ruminant placenta has been determined to be along the microvillous membrane in sheep and cattle (Wooding et al., 2005) and in the peri-implantation trophectoderm and extraembryonic endoderm of the ovine conceptus (Gao et al., 2009a).

Although GLUT1 and GLUT3 are both high affinity glucose transporters (approximately 5 and approximately 1.5 mM, respectively), GLUT3 transport capacity is the highest calculated of all the knownGLUT isoforms, thus facilitating proportionally greater glucose uptake (Thorens and Mueckler, 2010). This is supported by Ganguly et al. (2007), who reported that a null mutation of GLUT3 resulted in early embryonic mortality in mice due to increased apoptosis in blastocysts. Data from Crouse et al. (2016) in bovine chorioallantois found that GLUT3 expression was greater in preimplantation FM compared with postimplantation FM. Additionally, a GLUT3 null mice failed to survive after implantation, even in nutrient rich growth mediums, due to failed neurulation (approximately d 8.5; total gestation approximately 20 d; d 18–22 in bovines; Winters et al., 1942) or late-gestation fetal growth restriction characterized by decreased GLUT3-mediated transplacental glucose transport (Ganguly et al., 2007).

Glucose is not the most abundant hexose sugar to be utilized by the fetus, this being fructose (Wang et al., 2016). Glucose is metabolized to fructose, however, by the placenta and stored in ALF (White et al., 1979; Wu et al., 2004; Wang et al., 2016). Glucose concentrations are at maximum 1.1 mM in ovine ALF whereas fructose can range from 11.1 to 33.3 mM during gestation (Kim et al., 2012). Even so, glucose is required for stimulation of the mammalian target of rapamycin (mTOR) by decreasing adenosine monophosphate-activated protein kinase (Tan and Miyamoto, 2016) as well as being coupled with fructose and glutamine activation of mTOR (Wang et al., 2016) and stimulating the abundance of the phosphorylated forms of the mTOR cell signaling pathway proteins, thereby decreasing autophagy and increasing protein synthesis.

Cationic AA transporters SLC7A1, SLC7A2, and SLC7A3, also known as the CAT transporters (CAT-1, CAT-2, and CAT-3), are part of the y+ system of transporters, which are a facilitated diffusion sodium-independent group of transporters known for transporting cationic AA such as arginine and lysine and, at low pH, histidine (Closs et al., 2007). The 3 transporters studied vary in their stimulation and affinity; SLC7A1 exhibits Michaelis Constant values for l-arginine and l-lysine of 100 to 150 μM and is strongly stimulated by substrate on the trans side of the membrane (Kim et al., 1991; Closs et al., 1997); SLC7A2 and SLC7A3 exhibit lower substrate affinity and are less dependent on trans stimulation (Closs et al., 1997; Vékony et al., 2001), with SLC7A2 having about a 10-fold lower substrate affinity compared with SLC7A1 (Closs et al., 1993; Kavanaugh et al., 1994; Closs et al., 1997). Knockout of SLC7A1 resulted in decreased arginine transport by 73% and arginine and its catabolites, citrulline and ornithine, by 76 and 40%, respectively, as well as decreased ODC1 is Ornithine Decarboxylase 1, Nitric Oxide Synthase, and polyamines, which resulted in retarded growth development of the conceptus (Wang et al., 2014).

In all 3 cationic AA transporters investigated (SLC7A1, SLC7A2, and SLC7A3), greater levels of mRNA expression were observed during key days of gestation, d 16 at maternal recognition of pregnancy and implantation and d 28 to 40, the critical window of placental development, beyond which little embryonic/fetal loss occurs (Thatcher et al., 1994; Bridges et al., 2013). In ewes, mRNA of SLC7A1 and SLC7A2 increased through d 20 of gestation (Gao et al., 2009b). This is similar to what is reported in the current study, in which SLC7A1 and SLC7A2 increased in expression through d 28 to 42. Messenger RNA of SLC7A1 was determined to be most abundant in ovine uterine LE, sGE, and glandular epithelium and also in low abundance in conceptuses. Messenger RNA of SLC7A2 was weakly expressed in trophectoderm and endoderm of conceptuses during peri-implantation in the ovine (Gao et al., 2009b). Additionally, P4 stimulates expression of SLC7A1 but not IFN-τ, and SLC7A2 is induced by P4 as well as being stimulated by IFN-τ (Gao et al., 2009b). Establishing the cellular localization of these transporters as well as their influences by P4 and IFN-τ in cattle would provide additional insight into the function of these transporters in early gestation. In FM, SLC7A1 peaked in expression on d 34 and 50, coinciding with increased expression on d 34 in maternal tissues. Concentration of arginine was greater on d 40 compared with d 50 of gestation, following a pattern similar to that seen in maternal and fetal transporter expression, being greater on d 34 of gestation and decreasing to d 50.

Arginine is well known for its roles in angiogenesis and cellular proliferation as well as its actions on mTOR for protein synthesis and decreased protein degradation (Wang et al., 2016). When supplemented in diets of sheep, arginine increases embryonic and conceptus survival and growth rate (Wang et al., 2016), therefore suggesting that the amount of arginine transported into the uterine lumen and ALF and AMF by nutrient transporters is vital to conceptus survival. Nitric oxide is an important product of arginine catabolism and plays a vital role in placental angiogenesis and exchange of nutrients and oxygen from maternal to fetal systems (Gouge et al., 1998; Bird et al., 2003; Wang et al., 2014). Additionally, polyamines (produced from arginine catabolism) contribute to embryogenesis and placental development through their actions in DNA and protein synthesis, scavenging reactive oxygen species, cell proliferation, and differentiation of tissues (Wang et al., 2014). Supplemental lysine in the diet of rats reduced proteolysis and autophagy as well as upregulating the mTOR signaling pathway (Sato et al., 2015). Additional information regarding the significance of lysine in fetal mTOR pathways was not found in ruminants; however, mean concentrations of lysine were greater than those of arginine in our heifers, suggesting a role for lysine in conceptus viability.

Genes were greater in mean expression across all days in either CAR (GLUT3 and SLC7A3) or ICAR (SLC7A1) or both CAR and ICAR (GLUT1 and SLC7A2) compared with FM during the first 50 d of gestation. Although there was a general numerical increase in the expression of all transporters in FM, the overall expression of these transporters was never greater than the expression seen in either CAR or ICAR. Investigating specific cellular locations of these transporters using immunohistochemistry in future studies would provide greater insight into the functions of these transporters. Knowing temporal changes of transporters in endometrial and fetal tissues using immunohistochemistry, along with mRNA expression in uteroplacental tissues and nutrient concentrations in fluids, would provide a more complete picture of establishment and function of transporters in uteroplacental tissues. Ultimately, new knowledge in this area will facilitate increased efficiencies associated with beef cattle production and contribute to meeting projected world food demands.

 

References

Footnotes


Comments
Be the first to comment.



Please log in to post a comment.
*Society members, certified professionals, and authors are permitted to comment.