View Full Table | Close Full ViewTable 1.

Primer sets used for real-time quantitative reverse-transcription PCR

 
Gene1 Product size, bp Forward primer (5′–3′) Reverse primer (5′–3′) GenBank accession no. Source
GLUT1 2,533 CGGCTGCCCTGGATGTC GCCTGGGCCCACTTCAAA NM_174602 Mattmiller et al., 2011
GLUT3 1,404 CAAGTCACAGTGCTAGAGTCTTTC GGAGAGCTGGAGCATGATAGAGAT XM_001256170 Mattmiller et al., 2011
SLC7A1 695 CCGATAATCGCCACCTTAACCT ACCAGGTCCTTCAGGTCGAA DQ399522 Liao et al., 2008
SLC7A2 490 AAGGAAATGTGGCAAACT TTGAAAAGCAACCCATCCTC XM_865568.2 Gao et al., 2009b
SLC7A3 473 TACCAGCCTCTTGGGCTCTA AAAGCAGTGGAATGGACCAC BC126655 Gao et al., 2009b
1GLUT1 and GLUT3 = glucose transporter solute carrier family 2 members 1 and 3; SLC7A1, SLC7A2, and SLC7A3 = cationic AA transporters of arginine and lysine, solute carrier family 7 members 1, 2, and 3.



View Full Table | Close Full ViewTable 2.

Level of expression of nutrient transporters GLUT1, GLUT3, SLC7A1, SLC7A2, and SLC7A3 in caruncle (CAR) and intercaruncular endometrium (ICAR) tissue in nonpregnant (NP) controls and from d 16 to 50 of gestation1

 
Day of gestation2
Tissue Gene of interest NP 16 22 28 34 40 50 SEM3 P-value4
CAR5 GLUT1 1.00a 7.77c 4.34b 2.06a 1.38a 1.20a 1.70a 1.0 0.0001
GLUT3 1.00a 3.89a 5.62ab 4.80ab 9.13bc 4.93ab 13.68c 2.3 0.01
SLC7A1 1.00a 1.54a 1.99a 5.12b 6.82b 5.10b 0.98a 0.9 0.0001
SLC7A2 1.00 2.38 1.37 0.68 3.24 2.95 0.35 1.0 0.2
SLC7A3 1.00a 6.89b 0.69a 0.42a 0.52a 0.54a 0.14a 1.7 0.01
ICAR6 GLUT1 1.00a 13.24c 6.07b 2.48ab 1.65a 1.04a 0.66a 2.2 0.0001
GLUT3 1.00 0.93 1.67 4.32 4.90 3.51 0.73 1.7 0.06
SLC7A1 1.00a 2.03a 1.63a 6.30b 16.03d 12.02c 5.73b 2.0 0.0001
SLC7A2 1.00a 1.25a 1.23a 7.84bc 10.25c 4.08ab 2.15a 3.1 0.02
SLC7A3 1.00abc 0.50a 0.20a 1.87c 1.49bc 1.46bc 0.61ab 0.5 0.03
a–dMeans within a row without a common superscript differ (P < 0.05).
1GLUT1 and GLUT3 = glucose transporter solute carrier family 2 members 1 and 3; SLC7A1, SLC7A2, and SLC7A3 = cationic AA transporters of arginine and lysine, solute carrier family 7 members 1, 2, and 3.
2Day of gestation is the number of days after insemination. Day 0 is a nonbred NP control and serves as the baseline of expression for that gene. Each gene expression is given as a fold change in relation to NP level of expression.
3The average SEM across all days of gestation and NP heifers was used within gene of interest. Animals ovariohysterecomized on each day are as follows: NP n = 7, d 16 n = 9, d 22 n = 6, d 28 n = 6, d 34 n = 7, d 40 n = 6, d 50 n = 5.
4Probability values for effect of day on level of expression of individual genes. For those with a value of 0.0001, values are <0.0001.
5Caruncular tissue; caruncles taken from the uterine horn ipsilateral to the Corpus Luteum.
6Intercaruncular tissue; endometrial tissue not including caruncles; taken from uterine horn ipsilateral to the Corpus Luteum.



View Full Table | Close Full ViewTable 3.

Level of expression of nutrient transporters GLUT1, GLUT3, SLC7A1, SLC7A2, and SLC7A3 in fetal membranes from d 22 to 50 of gestation.1 Due to no second normalization, data are presented as change in cycle threshold (ΔCt) value2

 
Day of gestation3
Gene of interest 22 28 34 40 50 SEM4 P-value5
GLUT1 6.72a 6.35ab 5.58c 5.84bc 5.32c 0.3 <0.01
GLUT3 6.38 6.06 6.29 6.35 5.66 0.4 0.72
SLC7A1 9.93a 8.16b 7.05c 8.86ab 6.99c 0.4 <0.01
SLC7A2 6.76 6.05 6.09 4.77 5.57 0.6 0.14
SLC7A3 12.25 9.64 10.4 11.61 13.08 0.9 0.08
a–cMeans within a row without a common superscript differ (P < 0.05).
1GLUT1 and GLUT3 = glucose transporter solute carrier family 2 members 1 and 3; SLC7A1, SLC7A2, and SLC7A3 = cationic AA transporters of arginine and lysine, solute carrier family 7 members 1, 2, and 3.
2Lower ΔCt values indicate a higher level of expression.
3Day of gestation is the number of days after insemination. Values for expression of genes are provided as ΔCt values for that gene after being normalized to β-actin.
4The average SEM across all days of gestation was used within gene of interest. Animals ovariohysterecomized on each day are as follows:d 22 n = 6, d 28 n = 6, d 34 n = 7, d 40 n = 6, d 50 n = 5.
5Probability values for effect of day on level of expression of individual genes.



View Full Table | Close Full ViewTable 4.

Level of expression of nutrient transporters GLUT1 and GLUT3 in caruncle (CAR), intercaruncular endometrium (ICAR), and fetal membrane (FM) tissues in nonpregnant (NP) controls and from d 16 to 50 of gestation compared with NP endometrium tissue1

 
Day of gestation2
P-value5
Item NP 16 22 28 34 40 50 Tissue means3 SEM4 Day Tissue Day × tissue
GLUT1 1.9 <0.01 0.02 0.10
    CAR6 0.719 18.929 9.494 3.108 3.009 2.343 3.715 5.90h
    ICAR7 1.711 24.597 10.391 3.297 2.823 1.781 1.131 6.53h
    FM8 0.590 0.642 1.106 0.936 1.307 0.92g
GLUT3 2.7 <0.01 <0.01 0.01
    CAR 1.308abc 6.412abcd 9.254d 7.911bcd 15.044e 8.127cd 24.475f 10.36
    ICAR 0.258a 0.892ab 1.598abc 4.126abcd 5.339abcd 3.353abcd 1.183abc 2.39
    FM 1.407abc 2.105abc 1.956abc 1.774abc 2.494abcd 1.95
a–fMeans within a gene without a common superscript differ in day × tissue (P < 0.05).
g,hMeans different across tissue (P < 0.05).
1GLUT1 and GLUT3 = glucose transporter solute carrier family 2 members 1 and 3.
2Day of gestation is the number of days after insemination. The NP control equals a nonbred, NP control on d 0 and serves as the baseline of expression for that gene. Each gene expression is given as a fold change in relation to NP endometrium level of expression.
3The mean gene expression for the tissue across all days of gestation.
4 The average SEM for the day x tissue interaction was used within gene of interest. Animals ovariohysterecomized on each day are as follows: NP n = 7, d 16 n = 9, d 22 n = 6, d 28 n = 6, d 34 n = 7, d 40 n = 6, d 50 n = 5.
5Probability values for the effect of day, tissue, and day × tissue on level of expression of individual genes.
6Caruncular tissue (caruncles taken from the uterine horn ipsilateral to the Corpus Luteum).
7Intercaruncular tissue; endometrial tissue not including caruncles; taken from uterine horn ipsilateral to the Corpus Luteum.
8Chorioallantois d 22 and later.



View Full Table | Close Full ViewTable 5.

Level of expression of nutrient transporters SLC7A1, SLC7A2, and SLC7A3 in caruncle (CAR), intercaruncular endometrium (ICAR), and fetal membrane (FM) tissues in nonpregnant (NP) controls and from d 16 to 50 of gestation compared with NP endometrium tissue1

 
Day of gestation2
P-value5
Item NP 16 22 28 34 40 50 Tissue means3 SEM4 Day Tissue Day × tissue
SLC7A1 0.8 <0.01 <0.01 <0.01
CAR6 0.671a 1.291a 1.661ab 4.276def 5.699f 4.263cdef 0.687a 2.65
ICAR7 0.688a 1.393a 1.118a 4.330ef 11.026h 8.267g 3.944bcdef 4.40
FM8 0.086a 0.324a 0.624a 0.233a 0.624a 1.89
SLC7A2 4.3 <0.01 <0.01 0.07
CAR 5.718 7.625 7.143 4.25 16.904 10.189 1.841 7.67h
ICAR 1.098 4.856 4.777 19.137 28.267 15.914 8.388 11.78h
FM 1.077 2.761 1.657 3.861 2.605 2.39g
SLC7A3 4.5 <0.01 0.40 0.02
CAR 2.39a 28.049b 2.816a 1.69a 2.132a 2.191a 0.697a 5.71
ICAR 1.55a 0.771a 0.311a 2.9a 2.306a 2.267a 0.203a 1.58
FM 0.61a 1.603a 1.949a 0.634a 0.212a 1.00
a–fMeans within a gene without a common superscript differ in day × tissue (P < 0.05).
g,hMeans different across tissue (P < 0.05).
1SLC7A1, SLC7A2, and SLC7A3 = cationic AA transporters of arginine and lysine, solute carrier family 7 members 1, 2, and 3.
2Day of gestation is the number of days after insemination. The NP control equals a nonbred, NP control on d 0 and serves as the baseline of expression for that gene. Each gene expression is given as a fold change in relation to NP endometrium level of expression.
3The mean gene expression for the tissue across all days of gestation.
4The average SEM for the day x tissue interaction was used within gene of interest. Animals ovariohysterecomized on each day are as follows: NP n = 7, d 16 n = 9, d 22 n = 6, d 28 n = 6, d 34 n = 7, d 40 n = 6, d 50 n = 5.
5Probability values for the effect of day, tissue, and day × tissue on level of expression of individual genes.
6Caruncular tissue; caruncles taken from the uterine horn ipsilateral to the Corpus Luteum.
7Intercaruncular tissue; endometrial tissue not including caruncles; taken from uterine horn ipsilateral to the Corpus Luteum.
8Chorioallantois d 22 and later.



View Full Table | Close Full ViewTable 6.

Glucose, arginine, ornithine, citrulline, and lysine concentrations in allantoic fluid, amniotic fluid, and maternal plasma on d 40 and 50 of gestation

 
Fluid3
P-value6
Nutrient1 Day of
gestation2
Plasma Allantoic Amniotic Day mean4 SEM5 Day Fluid Day × fluid
Glucose 0.2 0.05 <0.01 0.10
40 5.08 1.33 1.06 2.35g
50 4.54 1.81 1.94 2.76h
Fluid mean7 4.59y 1.57x 1.50x
Arginine 58.4 0.03 <0.01 <0.01
40 118.13a 578.41b 164.12a 286.89
50 108.64a 237.97a 186.34a 177.64
Fluid mean 113.39 408.19 175.23
Ornithine 36.4 0.95 <0.01 0.51
40 76.15 154.05 62.35 97.52
50 64.71 153.11 76.51 98.11
Fluid mean 70.43b 153.58a 69.43b
Citrulline
40 73.71 12.54 Undetected 28.75 4.6 0.91 <0.01 0.13
50 65.01 22.58 Undetected 29.19
Fluid mean 69.36a 17.56b Undetectedc
Lysine 39.9 0.80 <0.01 0.31
40 103.07 671.64 209.01 327.91
50 96.65 597.35 264.88 319.63
Fluid mean 99.86x 634.50z 236.95y
a–cMeans within nutrient without a common superscript differ in day × fluid (P < 0.05).
g,hMeans across fluid within day without a common superscript differ (P < 0.05).
x–zMeans across day within fluid without a common superscript differ (P < 0.05).
1Glucose, arginine, ornithine, citrulline, and lysine.
2Day of gestation is the number of days after insemination.
3Concentrations of glucose (mM), arginine (μmol/L), ornithine (μmol/L), citrulline (μmol/L), and lysine (μmol/L) in maternal plasma, allantoic fluid, and amniotic fluid.
4Mean of nutrient concentration across fluid type within a given day of gestation.
5The average SEM for the day x fluid interaction was used within nutrient. Animals ovariohysterecomized on each day are as follows: d 40 n = 6, d 50 n = 5.
6Probability values for the effect of day, fluid, and day × fluid on the concentration of glucose, arginine, ornithine, citrulline, and lysine in fluids.
7Mean of nutrient concentration across day of gestation within a given fluid type.