View Full Table | Close Full ViewTable 1.

Nutritional and fatty acid profile (DM basis) of feedstuffs used in the experiment

 
Item Corn Protein–mineral mix1 Megalac-E2 Pasture3
TDN, % 86 78 193 59
NEm,4 Mcal/kg 2.16 1.89 6.98 1.05
CP,4 % 8.5 21.8 0.8 11.1
NDF,4 % 8.1 19.1 1.2 64.7
Total identified fatty acids,5 % 4.2 2.7 88.3 2.4
    Palmitic acid (16:0), % 0.88 2.02 15.77 0.50
    Stearic acid (18:0), % 0.03 0.37 4.54 0.13
    Oleic acid (18:1), % 0.33 0.00 27.32 0.16
    Linoleic acid (18:2), % 2.72 0.02 36.11 0.47
    Linolenic acid (18:3), % 0.09 0.11 2.89 0.99
1Centrum Peso 20 (MCassab Tecnologia Animal, São Paulo, Brazil).
2Elanco Saúde Animal (São Paulo, Brazil).
3Panicum maximum pasture.
4Values obtained from a commercial laboratory wet chemistry analysis (Dairy One Forage Laboratory, Ithaca, NY). The TDN concentration was calculated according to the equations described by Weiss et al. (1992). The NEm concentration was calculated with the following equation (NRC, 2000): NEm = 1.37 ME − 0.138 ME2 + 0.0105 ME3 − 1.12, given that ME = DE × 0.82 and 1 kg TDN = 4.4 Mcal DE.
5As a percentage of DM (Tripathy et al., 2010).



View Full Table | Close Full ViewTable 2.

Composition and nutritional profile of treatments offered in the experiment1

 
Item CSSO CON
Ingredients, % as-fed
    Ground corn 33.3 33.3
    Protein–mineral mix 33.3 33.3
    Megalac-E 33.3
    Kaolin 33.3
Nutrient profile, DM basis
    DM, % 91.7 93.0
    TDN,2 % 120.3 53.7
    NEm,3 Mcal/kg 3.74 1.32
    CP, % 10.2 10.0
    NDF, % 9.36 8.94
    Total identified fatty acids,4 % 32.8 2.25
        Palmitic acid (16:0), % 6.40 0.95
        Stearic acid (18:0), % 1.70 0.13
        Oleic acid (18:1), % 9.54 0.11
        Linoleic acid (18:2), % 13.36 0.89
        Linolenic acid (18:3), % 1.06 0.07
Daily intake
    DM, g 275 279
    TDN,2 g 331 147
    NEm,3 Mcal 1.02 0.36
    CP, g 28.1 27.4
    NDF, g 25.7 24.6
    Total identified fatty acids,4 g 90.1 6.2
        Palmitic acid (16:0), g 17.60 2.62
        Stearic acid (18:0), g 4.67 0.36
        Oleic acid (18:1), g 26.24 0.29
        Linoleic acid (18:2), g 36.74 2.44
        Linolenic acid (18:3), g 2.92 0.18
1Cows received (as-fed basis) 100 g of a protein-mineral mix + 100 g of ground corn per cow daily, in addition to: 1) 100 g/cow daily of Ca salts of soybean oil (CSSO; Megalac-E, Elanco Saúde Animal, São Paulo, Brazil; n = 10), or 2) 100 g/cow daily of kaolin (CON; rumen-inert indigestible substance; n = 10).
2Calculated according to the equations described by Weiss et al. (1992).
3Calculated with the following equation (NRC, 2000): NEm = 1.37 ME − 0.138 ME2 + 0.0105 ME3 − 1.12, given that ME = DE × 0.82 and 1 kg TDN = 4.4 Mcal DE.
4Estimated from the treatment consumption of each individual experimental unit.



View Full Table | Close Full ViewTable 3.

Primer sequences, accession number, and reference for all gene transcripts analyzed by real-time reverse transcription PCR

 
Target gene Primer sequence Accession no. Source
Genes of interest
    20,50-oligoadenylate synthetase
        Forward ACCCTCTCCAGGAATCCAGT NM 001040606 Fricke et al. (2016)
        Reverse GATTCTGGTCCCAGGTCTGA
    Cyclooxygenase-2
        Forward TCCTGAAACCCACTCCCAACA NM_174445 Takagi et al. (2008)
        Reverse TGGGCAGTCATCAGGCACAG
    Interferon-stimulated gene 15
        Forward GGTATGAGCTGAAGCAGTT NM_174366 Fricke et al. (2016)
        Reverse ACCTCCCTGCTGTCAAGGT
    Interferon-tau
        Forward GCCCTGGTGCTGGTCAGCTA AF238612 Rizos et al. (2003)
        Reverse CATCTTAGTCAGCGAGAGTC
    Myxovirus resistance 2
        Forward CTTCAGAGACGCCTCAGTCG NM 173941 Fricke et al. (2016)
        Reverse TGAAGCAGCCAGGAATAGTG
    Prostaglandin E synthase
        Forward CGCTGCTGGTCATCAAAAT NM_174443.2 Takagi et al. (2008)
        Reverse GGAAGGGGTAGATGGTCTCC
Reference genes
    β-actin
        Forward CTGGACTTCGAGCAGGAGAT AY141970 Gifford et al. (2007)
        Reverse GGATGTCGACGTCACACTTC
    β2-microglobulin
        Forward GGGCTGCTGTCGCTGTCT NM_173893 Silva et al. (2008)
        Reverse TCTTCTGGTGGGTGTCTTGAGT
    Glyceraldehyde-3-phosphate dehydrogenase
        Forward ACCCAGAAGACTGTGGATGG NM_001034034 Cerri et al. (2012)
        Reverse CAACAGACACGTTGGGAGTG
    Ribosomal protein L19
        Forward ATTGACCGCCACATGTATCA NM_001040516 Monteiro et al. (2014)
        Reverse GCGTGCTTCCTTGGTCTTAG
    Suppressor of zeste 12 homolog
        Forward GAACACCTATCACACACATTCTTGT XM_582605 Walker et al. (2009)
        Reverse TAGAGGCGGTTGTGTCCACT
    Zinc finger protein 131
        Forward AGAAAGAAGCTTTATGAATGTCAGG NM_001101218 Walker et al. (2009)
        Reverse GTTTATCTCCAGTGTGTATCACCAG



View Full Table | Close Full ViewTable 4.

Plasma fatty acid concentrations (mg/mL of plasma) of beef cows supplemented or not with 100 g of Ca salts of soybean oil1,2

 
Item3 CSSO CON SEM P-value
Mystiric acid (14:0) 0.263 0.214 0.018 0.07
Myristoleic acid (14:1) 0.176 0.163 0.011 0.44
Palmitic acid (16:0) 0.219 0.188 0.013 0.02
Stearic acid (18:0) 0.347 0.285 0.020 <0.01
Oleic acid (18:1) 0.197 0.206 0.019 0.39
Linoleic acid (18:2) 0.386 0.199 0.025 <0.01
Linolenic acid (18:3) 0.133 0.116 0.06 0.06
Total SFA 0.964 0.783 0.054 0.03
Total MUFA 0.376 0.367 0.022 0.57
Total PUFA 0.523 0.315 0.033 <0.01
Linoleic:linolenic acid ratio 3.03 1.72 0.17 <0.01
Total identified fatty acids 1.863 1.465 0.073 <0.01
1Cows received (as-fed basis) 100 g of a protein-mineral mix + 100 g of ground corn per cow daily, in addition to: 1) 100 g/cow daily of Ca salts ofsoybean oil (CSSO; Megalac-E, Elanco Saúde Animal, São Paulo, Brazil; n = 10), or 2) 100 g/cow daily of kaolin (CON; rumen-inert indigestiblesubstance; n = 10). Treatments were offered from d 0 to 21 of the experiment.
2Blood samples were collected from all cows (n = 100; 50/treatment) on d 0 (before the first treatment application), 7, and 15. Values obtained on d 0 served as covariate; therefore, reported values are covariately adjusted means.
3SFA comprise mystiric, palmitic, and stearic acids; MUFA comprise oleic and myristoleic acids; PUFA comprise linoleic and linolenic acids.



View Full Table | Close Full ViewTable 5.

Ovarian and pregnancy factors in beef cows supplemented or not with 100 g of Ca salts of soybean oil1,2

 
Item CSSO CON SEM P-value
Ovarian factors
    Dominant follicle diameter (d 0), mm 13.2 13.0 0.5 0.51
    Corpus luteum volume,3 cm3 3.25 2.76 0.19 0.04
    Plasma progesterone,3 ng/mL 4.58 3.89 0.29 <0.01
Pregnancy factors
    Proportion of cows with conceptus,4 %
        Day 15 40.4 36.3 9.0 0.75
        Day 30 43.5 40.1 12.0 0.85
    Conceptus length5 2.58 1.15 0.59 0.04
    IFNt6 uterine flushing media,5 ng/mL 19.3 15.6 3.7 0.49
1CSSO =Cows received (as-fed basis) 100 g of a protein-mineral mix + 100 g of ground corn per cow daily, in addition to: 1) 100 g/cow daily of Ca salts of soybean oil (CSSO; Megalac-E, Elanco Saúde Animal, São Paulo, Brazil; n = 10), or 2) 100 g/cow daily of kaolin (CON; rumen-inert indigestible substance; n = 10). Treatments were offered from d 0 to 21 of the experiment. Results are covariately adjusted to estrus expression (Estrotect; Rockway Inc., Spring Valley, WI; Thomas et al., 2014) from d −2 to 0 of the experiment.
2Transrectal ultrasonography (7.5-MHz transducer, 500 V; Hitachi Aloka Medical America, Inc., Wallingford, CT) was performed on d 0, 7, and 15 of the experiment. Blood samples were collected for progesterone analysis on d 7 and 15. Conceptus and uterine flushing media collected via transcervical flushing (Ribeiro et al., 2016) as well as endometrial biopsy (Cerri et al., 2011) were performed on d 15. Values reported are overall means originated from main treatment effects.
3Evaluated from cows that did not have a corpus luteum on d 0 but with a corpus luteum greater than 0.38 cm3 in volume on d 7 (n = 47 for CSSO and n = 46 for CON) and 15 (n = 46 for CSSO and n = 45 for CON). Corpus luteum volume was calculated using the formula for volume of a sphere: volume = 4/3π × (D/2)3, in which D is the maximum luteal diameter (Cooke et al., 2009).
4On d 15, 30 cows per treatment were assigned to transcervical flushing for conceptus collection. On d 30, pregnancy status of the nonflushed cows (20 cows/treatment) was evaluated via transrectal ultrasonography (5.0-MHz transducer, 500 V; Hitachi Aloka Medical America, Inc., Wallingford, CT).
5Evaluated from cows that had a conceptus collected via transcervical flushing.
6IFNt = interferon-tau.



View Full Table | Close Full ViewTable 6.

Expression of genes associated with pregnancy establishment in the endometrium, conceptus, and blood from beef cows supplemented or not with 100 g of Ca salts of soybean oil1

 
Item CSSO CON SEM P-value
Endometrium2
    Cyclooxygenase-2 6.90 4.89 1.50 0.37
    Prostaglandin E synthase 5.34 4.21 0.76 0.30
Conceptus3
    Interferon-tau 21.0 5.1 5.0 0.03
    Prostaglandin E synthase 7.89 2.99 1.49 0.02
Blood cells
    Interferon-stimulated gene 15
        Pregnant 33.8 23.7 2.6 <0.01
        Nonpregnant 2.88 5.88 2.2 0.34
    Myxovirus resistance 2
        Pregnant 47.1 27.6 4.2 <0.01
        Nonpregnant 5.70 11.19 3.5 0.27
    20,50-oligoadenylate synthetase
        Pregnant 48.1 35.2 3.8 0.02
        Nonpregnant 5.38 9.80 3.2 0.34
1Cows received (as-fed basis) 100 g of a protein-mineral mix + 100 g of ground corn per cow daily, in addition to: 1) 100 g/cow daily of Ca salts of soybean oil (CSSO; Megalac-E, Elanco Saúde Animal, São Paulo, Brazil; n = 10), or 2) 100 g/cow daily of kaolin (CON; rumen-inert indigestible substance; n = 10). Treatments were offered from d 0 to 21 of the experiment. Results are covariately adjusted to estrus expression (Estrotect; Rockway Inc., Spring Valley, WI; Thomas et al., 2014) from d −2 to 0 of the experiment.
2Conceptus and uterine flushing media collected via transcervical flushing (Ribeiro et al., 2016) as well as endometrial biopsy (Cerri et al., 2011) were performed on d 15 (30 cows/treatment). Only samples from cows with a retrieved conceptus were analyzed. Values are expressed as relative fold change compared with the threshold cycle of reference genes analyzed within the same sample (Ocón-Grove et al., 2008).
3Blood samples collected from nonflushed cows (20 cows/treatment) into PAXgene tubes (BD Diagnostics, Sparks, MD) for whole-blood RNA extraction on d 20 of the experiment and analyzed according to cow pregnancy status on d 30. Values are expressed as relative fold change compared with the threshold cycle of reference genes analyzed within the same sample (Ocón-Grove et al., 2008).